Transcript

slc37a4b-201

ID
ZDB-TSCRIPT-110325-2664
Name
slc37a4b-201
Previous Names
  • ottdart00000050930
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050930 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050930|OTTDARG00000035750|ZDB-GENE-040426-827 slc37a4b|OTTDARP00000040000 slc37a4b-001 LG_ CU633908.12 Danio rerio protein_coding KNOWN, 2205 bp
ACATGAGGTCTGTCTGAGCACAGTGTTGAAATCTCTTCAT
GCACATCACAGTGAATGCCGGCTGAAGAAAACCTCCGTTC
AGCTTTGAGGAACCAGGAGAGGAGCTGAAAACAGAAGCCG
GATGAAATGATCTTGACCTGTGGATCAGTTTTGGAATGTG
TCGTAATCTAGGTTATCAGATCTGATAGATTTCAAGTGCT
CCATTTCCCCCAAATTTTATTTATTTTTTTGCTCTTATTT
ATTATCATTTTATAATCTTACATCTGCAATCATGGGAGCA
GCAGGTTACGGATATTATCGCACCGTTATATTCATCTCTA
TGTTTGTGGGATACATGCTTTACTACTTCAACCGGAAGAC
TTTTTCCTTTCTGATGCCATCCGTGATGGAGGAGATTGAG
CTGGATAAAGAAGAGCTTGGACTGATCACCAGCAGTCAGA
CTCTGGCCTATGCTATCAGTAAGTTCATCAGCGGAGTGCT
TTCAGACCGGATCAGCGCTCGCTGGCTCTTCTCCATCGGC
CTCTTCATTGTTGGTACCATAAACATCGCCTTCTCCTGCT
CCTCCACGGTCATGCTGTTCACCGTGCTTTGGTTTGTGAA
TGGATTCGGTCAGGGCTTCGGCTGGCCACCGTGTGGAAAG
GTGCTCCGGAAGTGGTTTGAACCGTCTCAGTTTGGGACGT
GGTGGGCCATCCTATGCTGCAGTATGAATCTGGCAGGTAG
TCTGGGCCCCATCATCACTACAGTGCTGGTCCAGTATTAT
GACTGGAGGGTCATCATGTCCGTGTCTGGGCTGATCTGCA
TGGCCGTCGCTGTTGTTTGCCTTCTGATGGTCAAAAACGA
GCCCAGTGACGTCGGGCTGCCCAGCATTCAGCCTGGAGCT
AAAAAGGGCAAGGGGAAGAAGGGAGGCCCTAATGATGAAA
GCAGTCTAAAGGATTTCCTGCTGTCTCCTTACCTGTGGGT
TCTGTCTGCCGGATACCTGGTTGTGTTTGGGGTAAAGATC
GCCTGCACTGACTGGGGTCAGCTGTTCCTCATGCAGGAGA
AAGGCCAGTCTGCCATGATGGGCAGCTCGTACATGAGTGC
GCTGGAAGTTGGTGGGTTTTTTGGCAGCATTGGAGCTGGT
TATCTGTCTGACAGGGCTGTTGCTAGGCAAGGGCTGGGTG
TTTATGGCAATCCTCGTCATGGGCTGCTCCTGATGATGAT
GGCAGGGATGGCTGTGTCCATGTACCTCTTCCGGGTTACC
ATCACACCAGAAACCCCAGAGGAAGCACCGCTGTGGGTTC
TGGCTCTACATCCAGTTTCAGTCCTCACTGGTGTCTCGGA
GAAAGAGCTTTGGATTCTGATTCTTGGTGCTGCATTTGGA
TTTTCCTCATACGGACCAATCGCCTTGTTCGGAGTGATTG
CGAGTGAAAGCGCCCCATCCAACTTCTGCGGGACGTCCCA
CGCCATTGTAGCTCTGATGGCAAATGTTGGTGCATTCATT
GCCGGCCTGCCATTCAGTACCATTGCCAAACGCTACAGCT
GGGACACAGCATTCTGGGTAGCAGAGGTCTCCTGCGCCAT
AACCACAGTTTGTTTCTTCTTCGTCCGTAACATGCGCACA
AAAATGGGCCATGTGCCTAAAAAGATGGACTAATCCTCTT
ATTAAATCCAATCAGAGAGCCCTGCCAATGTGAGAGCACT
CGGACAGGACATTTACATGCCAGTGAAGCATTAATGTATA
TTTTTATCACGCATCTCCATTCGTTTTATTATTATAATAA
TATTTGTTTCTCAAGCTTATTCGGCAGCAATATCAGACAT
TATTTTAGAGATAAACCTTTTGTTACTGTAAAAACAGAAA
TGTTTACACACTTTTTGAGCACGGAGAGCTGTTTACTTTC
TTAGTATTTATTAACATGAATCATTTCACACGAATGTTGT
TTGATTCGCGTACGATTGTCCAGTGTTTAAGTTACATTTC
AAGAGCTTTGGTGTTGAAATGAGCTTAAATGTACTGTATT
GTTGTTTTGCACTTGAAACATCTGTCATTTTGTCACCAGA
ATAAGTGGTTTTGTTTGTTTCAGCACATGTCATCAATTCA
AACAAGTCACATGAAACCAGCAGTATAATATAGAATGTAT
AAAAGTGTAAAAATGTAGTATAAAAGTTAATTGTATGTGT
ACTTATTGTTGCTTATGTGTCAACAGGATTATTTTAAATA
CTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations