Transcript

trim44-002

ID
ZDB-TSCRIPT-110325-2655
Name
trim44-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050894 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050894|OTTDARG00000035736|ZDB-GENE-050522-37 trim44|no_translation trim44-002 LG_ CU207301.28 Danio rerio protein_coding KNOWN, 423 bp
AGAGAGGAGGATGCAGGAGGACGAGCGGTCAGAAACACAT
ACAAACACACACACACACACAGCACAAAGACAGGGCACAC
CCCTGCTGGTTACGAGAGGGTACTGCAAGTAGAGAAGCGT
GAACAGCAGATGATTAGTGTGGACACAGATATGATCAGTG
TGAACGTCTCTTAACTCCTGCTCTCCGCTCTGTGTTTCAG
GATCCTGATGTGCGGCTCAGAGTTGCGGATCAGAGGAGGA
ATCCTGACGCTCCGTCAGCTGTTGAAGACAGAGGAGACGC
ACACGTCGGACACACACCCTGAACGCAGCTCTCTCTTCAG
GAATGGAGACAAACACAGAATCAAATGCAGGAACAAACAC
CAAACTCTTGAAGAATGTGCTGTCTTTATCAGTTCATTAT
TTTCATGAAGATCTAGTGGACTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations