Transcript

gprc5c-201

ID
ZDB-TSCRIPT-110325-2650
Name
gprc5c-201
Previous Names
  • gprc5c-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050875 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050875|OTTDARG00000035722|ZDB-GENE-070928-27 gprc5c|OTTDARP00000039953 gprc5c-001 LG_ AL954682.6 Danio rerio protein_coding KNOWN, 1940 bp
GTAAAGGCTTGGTCGAGCGCGCTCGCAAGAGAAACTGAGA
GTTTGAGTCACATCATTGGCGGCTGAAAGCTATCAAAACT
CGCCAAGTGTTTGCCCCCGACTATCCTTGAGGTTTTTTGA
AGGTTTGTTTGCCTGGAATACAAAGGGAACATTGTTGTTT
CAGGGTTTAATACCTCAACTTAGCTCTCTGGCACATTTTG
GCGTCGCGATGTCTTATTTATTTGCATGCACTTGCTGGAA
AAGGTAAATCAATCGTATACCAAAGAGTACTAGAGAGTTT
ACACAGAATCTACCCCTGACTACAAAAGGTGCTGGCAACC
ATGGATAACTTCATCTCCATATCCCACTGTTTTCATCTGC
TCTTTATTGCGTTATGTGTCCTGCCTGGATCTCTGGCCCA
AACCTCAATCCCCAGAGGTTGTGGAACCAACATGGACTCC
TTGTATTTTAACTTATGTGACCTCAGTGCAGTCTGGGGTG
TAGTAGTCGAGGCGTTTGCGGCTGCAGGTTTGGTGGCTTC
TTTGATTCTTCTTATTGTCCTGCTGGCCAGCCTTCCCTTC
ATCAACAGCAAGAATTGGCGCAGTTCGTTTGGACTTCACA
CGGTTTTTCTGATCTTCACATTTGGCCTGTTCGCCCTCAC
ATTCGCCTTTATCGTTGGGAAGAACTTCGCCACTTGCGCG
TCTCGTCGCTTTTTGTTTGGGGTGTTATTCGCCGGATGCT
TCTCATGCCTTCTTATGCAAGCCGTAAGGTTGAACATATT
AGCCAGGAGGAACTCGGGGCCGAGAGGTTGGGTTTGGTGT
TTGGGCGCTCTAGGACTCTGGTTGGTGGAAGTAGTCATCA
ACACTGAATGGCTAATCATTACGATTGTACGATACCCAGT
TAACATAACCGGAACCATTGCTCCTGTATTAGCCATTCCC
TGTAACATTGGCAATCAGGATTTTGTTATGGCGCTAATAT
ACGTCTTAAACCTACTGTTAGCAGTCGTAGTAGCATCCGT
ACCCATAATGGCAGGCAAACACAAGCAATGGCGCAAAGAC
GGAGCCCTCATTCTGGTCACAGGACTGCTTTCTGTGGGCA
TCTGGGTGGCGTGGATTGTCATGTATGTGTCCGGGAATGC
AAAAAATGGTGGACCGACGTGGGACGACCCTACATTGGCG
ATAGCGTTGGTGTCTAACGCATGGGTTTTTCTGCTGCTCC
ACACGGTGCCGGCGGTGTGTAGCCTAAGTGAGGAAGGGGA
AGATGAACCTGTTGCAGAAGACATGTACCCAAGCAGAGGG
TACGAGAACATGCTGAAGGAGCAAAGCGCACAGAATATAT
TTATGGAGAATAAGGCCTTCTCCATGGATGAGCCTAATGC
AGGTAACAAGCCTGTGTCTCCATACAGCGGCTATAACGGC
CAGCTGCGCAGTTGTGTTTACCAGCCGACAGAACTGGCTA
TCATCACAAAAGGAACGGGAAATCAGTTGGAATCATATGA
CAATGTAATTCCTCGAGCGTCCACAGGCACTCCACCCCGA
GCCCAGAGCGGCAGCACCAGCCCCACGACACAACTTGAAG
ATATGAGAAAAATATATACGAATGGAAATTTCATCAGGAG
ACCCCAGTGATCAACTCATGACAGGTGTTATTTTTCCTGG
CATTTCTGAATTAATTATTTAGTTTTTCCATCGCTGTGGT
CGACTGGACAGTCCAACTTGAACTCGGACGAACTCTGAGC
AACACTTATTTTAGTTTGCTCCACCAAAAGGCAACACGAT
CAGTTACTGTACCTGATATTGTACAGTACAGGCTTGTTTG
TGCATGGGACACATAAAAAAAGATTAGCTGTACCCGTGAT
TGTATAGACTACTGCAATGCTACCAGCTGTGTTTGCTAAA
GAAAGCACAGGTCAGCAAAGGGCTGTAAAATAAAGGTGTG
CTGGATTTCTGTCACTGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations