Transcript

ano5a-201

ID
ZDB-TSCRIPT-110325-2610
Name
ano5a-201
Previous Names
  • ano5a-001
  • dkey-261m9.4-001
  • si:dkey-261m9.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050701 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050701|OTTDARG00000035607|ZDB-GENE-091013-2 ano5a|OTTDARP00000039812 DKEY-261M9.4-001 LG_ CR762436.8 Danio rerio protein_coding NOVEL, 2918 bp
CGTAAACAGCAAAGGAGACCCAAGACCAACCCGAGTGGGC
ATATCAGATCCGCTGAGCGTGAAGTAAGCGGTCAGTCCTC
GGGCACTGGAGATCAGATCACGGGGCGTGGGCTCCGGAAA
GATCTTTCACTTATACAACTACAACAAATTAGTTCACTTC
AAGACTGAAAATGAATCGCGGATCGCAAAAGTCGAGTGAT
GAGACGCTTATAGAAATGAGCCGAACTGCTTGGTCCAGCG
GCGAAGACAACAATGGCTTCCATTCCAATTCGGATAAGGA
GACGTTTCAACTTGAGAATGCTGAGGTGGATAAACAGCAG
CAGAGTAAGGACTCTGTGTACTTCAGGGATGGTGTACGGA
GGATAGATTTCGTCCTGTCTTACATCGACGACAAGGATGG
AGAAAAGAAACAGGACCGAAGGAAGGTGTTTGAGGCTAAC
TTACAGAAAGCCGGACTGGAGGTGGAGACCGAGGACAAAT
CTGAGTCTGAGGATGGAAAGACGTACTTCTTGAAGATCCA
CGTTCCATGGGAGGTGCTGGCGACATATGCCGACGTCCTG
AAAATCAAAGTGCCTTTCAAAGCCAACGATATTCCTGAAA
ATAAAGAGATACCGATGGGCTGGCTCTTCACGCCCTTCCG
CCTGCCCGACCATGTGATGAATCCAGAGCCCGACTTCTTC
ACCTCCACGTTCGACAAGAGCAAGATCGACTTCTTCCTTA
TTGAAGATAAAGAAACCCTCTTTCCTGCGTCCACGCGCAA
CAGGATTGTTTATTACCTCCTTTCCCGAATCCCGTACAGC
ACAGAAGACAAAGATAAGAAGGGTATTAAGAGGTTGCTGA
ACAACGGGACCTACACGTCCGCCTTCCCTCTGCATGACTG
TCGATATTGGACCAGGTCTCGTGATGATAACTGTGAGAGC
GAACGCTATTCTCTGTATAAAAACTGGGCTCGCTTCAGCA
GCTTCTACAAGGAGCAGCCGCTCAACCTCATTCGGAAGTA
CTATGGAGAGAAGATCGGCATCTACTTTGCTTGGCTGGGT
TTTTACACGGAGATGCTGTCCTATGCTGCGGTTGTGGGTT
TACTCTGCTTCATCTATGGAGTGGCCACCTTTGACGAAAA
CATCTGGAGTCGAGAGATCTGCAACGAGACCATCGGTGGG
CAGATTGTCATGTGTCCGCTCTGTGATAAGAAATGCGGCT
ACTGGAAGCTCAGCACTACCTGCAGCTCTTCATGGCAATC
TTATTTATTTGACAATGCAGCGACGGTGTTCTTTGCTATA
TTCATGGGAATATGGGTCACTTTATTCCTGGAGTTCTGGA
AGCGGCGTCAGGCCCGGCTGGAGTACGAGTGGGATCTGGT
GGACTTTGAGGAAGAGCAACAGCAGCTCCAGCTCAGACCC
GAATACGAGTCCAAGTGCACCAATCGGCGACTCAACCGCG
TCACACAGGAGATGGAGCCTTATTTACCTCTAACAAGCAA
GTGTGCTCGTTCAATACTGTCTGGGGCCACCGTCCTCTTC
TGGATCTCTCTGATTATCGCCAGTATTATCGGTGTGATTG
CGTATCGTCTGGCGGTGTTCGCTGCATTCGCGAGCATCAT
GAAGGACAGTCCCACTAATAAGCTGGAGATAGTGGGAAAC
CTGATCACGCCTCAGTTCGCTACGTCTGTAACGGCGTCCT
GCATCAACTTTGTCATCATCATGGTGCTGAACTTCCTGTA
TGAGCGCGTCGCCATCAAGATCACTGATATGGAGGTCCCT
AAAACACACGTCGAGTACGAGAACAAGCTGACGATAAAGA
TGTTCCTCTTCCAGTTCGTCAACTATTATTCCTCCTGCTT
CTACGTTGCTTTCTTCAAGGGTAAATTTGTGGGATATCCT
GGAAACTACGCCTACATGTTTGGGCCTTGGAGTGGACTGA
GAAATGAAGAGTGTGAGCCTGGCGGCTGTCTGATCGAGCT
GACCACTCAGTTAGTGATCGTGATGGTGGGCAAGCAGGTG
TGGGGGAACATTCAAGAAGCTCTCGTCCCCTGGCTGCGTA
ACTGGTGGGTGAGCAGAAGTGCTCGTAATCATCCGGAGAG
TCTGTACAGCCGCTGGGAGCAGGATCACGATCTGCAGAAC
TTGGGGCAGCTCGGCCTCTTCTACGAGTACCTGGAGATGG
TGATTCAGTTTGGCTTCATCACTCTGTTCGTGGCCTCTTT
TCCTCTGGCTCCGCTCCTGGCTCTGATGAATAATATCCTG
GAGGTGCGCGTGGACGCCTGGAAGTTCACCACTCAGTTCC
GCAGACCCGTCGCTGCTAAAGCGCACAGCATCGGCGCCTG
GGAGGAAATCCTCAACATGATCGCAGTCTTCTCCGTCGTC
ACCAACGCTTTCATCGTGTCCTTCACGTCTGACATGATCC
CGCGGCTGGTGTACCAGTACGTGCATAATACGGGCAATGC
GGCCTCTATGTCGGGATACATCACCCACAGCCTCTCCATC
TACAACATCTCAGAGTTTCCTCCCGAAAACCGTCCGGATG
ATGACGAAAACCCAGACTGGTTCAACGCCGGCAACTACAC
CACCTGCAGGTATCGAGATTATCGATATCCTCCAGGACAC
GAGAAGCAGTACACCCACAACATGGACTTCTGGCACATCC
TCGCCGCCAAACTGGCATTCATCATCATCATGGAGCATGT
GGTGTTTGTGGTGAAGTTTTTCGTGGCGTGGTTGATCCCC
GACGTGCCTTCAGACGTAAAAGCGCGTGTAAAGCGCGAGC
GTTACCTCATCCAGGAGTATCTGCACGACTATGAGGTGGA
AAAACTGAAGAACCAGCTCAGCCTGAACACTGACGTCCAC
AATGACATTACGGCATGCACCTGTCCCACCACAGACGCCA
TCCCCAAACTGGAGGTATTATCAGACTGTCTGACCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations