ZFIN ID: ZDB-TSCRIPT-110325-2580
Transcript Name: chrnb1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050542 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050542|OTTDARG00000035508|ZDB-GENE-070821-4 chrnb1|no_translation chrnb1-002 LG_ BX649313.6 Danio rerio protein_coding KNOWN, 990 bp
GGGAGAAGATGGGTCTTTCCATCAATGTACTGCTGACTTT
GACTGTCTTTCTGCTTCTGCTGGCCAACAAAATCCCAGAA
ACATCTCTGGGTGTTCCTATTATTGTCAACTACCTGATGA
TAACCATGATCCTGGTCACCTTTTCTGTCATCCTCAGTGT
CGTGGTGCTCAACCTTCACCATCGCTCACCAAACACACAC
CAAATGCCCCTCTGGGTGCGCAAGATATTTATCCATATGC
TGCCTCCATACTTGGGAATGCTGCGACCTAAAGTGGAGAC
CCCTCTGTTTCTTGAAAAACCTGCCAAAAAGGAGAACATT
CAAGCCATCAGCAGAGTAGCAGACGAGTACTTCATCCGCA
AGCCCAGCAACATGAACTTCCTCTTCCCTAAACCCCACAG
GTGAGCTCCCAGGTTTTTCTGTAGCTCCCTGATCATTAGG
GTCACAGGTCAAGTAGATTTTGCAGAAAAAAAAGTAAACT
CAAATTGACCCTCATATTAGGGCCAGTTCCTAGTGTGAGA
AATTGACCTGTACAACTGTTTCAAGATAATAATTGCGATT
ACGCAAGCCACAAATACTCCATAAGAGATCATTTTAAACA
TTTTGAATCAATGCACTCTATGGCACCTTTAAAAATCTGG
CAATCAAAGTCTAAAGCTGAACTTTAATCCAAATTTGAAA
GATATTGAAATTGTATGACTATGATAGTTTAACTCTTAAT
CCTGGCTCACAAAAAAAACTTGAACTCAAGATTAACATAA
CAGTGTCATCCGTTAATGTGGATGCCAAAATACACTTACA
GTTATCTTTCTAATGCTTACTGTGAACGGCCTTCATAGGT
TCTTGTTTCCATGTGGTTTAGCTGGTATAGTTAATTTTTA
TAATTATGAGTTAATTTTTCTAATTAAAAGTGTAACTTGA
GTTGCTTTGCCGATTATGTGTTTTGTAATAAAATGCTGCA
TGTTTAATTAGAAAAATGCAAAACAGGGGC

chrnb1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA chrnb1-201 (1)    Ensembl 4412
ncRNA chrnb1-002 990
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chrnb1-002 Contained in:
[BAC] DKEY-112A7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050542 (1),  Ensembl_Trans:ENSDART00000149774 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH568672 (1) 991 nt
CITATIONS (2)