ZFIN ID: ZDB-TSCRIPT-110325-2558
Transcript Name: dld-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050446 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050446|OTTDARG00000035451|ZDB-GENE-990415-47 dld|OTTDARP00000039600 dld-001 LG_ CU855920.4 Danio rerio protein_coding KNOWN, 3339 bp
AGTCAGTCTCTCACATGGAAACAAGAGTACGGGATGAAAG
TTTGGATCAGTAGTTTGGATCATCTCCACATGAACTTTTG
AAACGGAAAATAAGCGCATAAATAACCCTGTGCTTGGGGC
TTTGTAATTTTTCCGGCTTCCTAAACTACCCGAAAGTGGA
CTGCTAACTTTTTTGACAACTTGGAGTACTCGACTTGTGA
GGGATTTCCCAATCGTCTCCCTTTTGCGCATCGGGGTTTC
CTCCTTCTACATTCGTATTTGGGATTTAATTGCTGATTTA
TTTTCCAAGGGGGGACTTTGATGGGCTTGCATGAGCAGAT
AAACTGAACACAACAGAGCATCAACCCGAGCTGCCTCCCA
CTGAGCGGAGAACGACGAGTCTCAATGATTTATTGAGACA
CGGTCTCACACAATTGCCTGGCCCGTGGAAGTTTCACAAC
AGTTCAGATCCTCTCCGCCATGGGACGACTAATGATAGCT
GTTTTGCTTTGTGTCATGATAAGCCAGGGGTTTTGTTCAG
GGGTTTTTGAGCTAAAGTTGCAGGAGTTTCTGAACAAGAA
AGGAGTGACAGGCAACGCAAACTGCTGCAAGGGATCCGCG
GCAGAGGGTCTTCAGTGTGAATGCAAAACTTTTTTTAGGA
TTTGCCTGAAACATTACCAAGCCAACGTATCTCCAGATCC
TCCGTGCACCTACGGTGGCGCAGTTACCCCGGTGCTCGGA
TCAAACTCCTTCCAAGTTCCCGAAAGCTTCCCTGACAGCT
CGTTCACCAACCCCATTCCTTTCGCGTTTGGGTTCACATG
GCCAGGAACATTTTCGCTGATTATTGAAGCACTGCACACC
GACTCCACTGATGACCTGTCTACAGAAAACCCAGACCGTC
TGATCAGTCGCATGACCACCCAGAGGCATCTAACAGTAGG
CGAGGAATGGTCCCAAGATCTACAGGTTGGTGGGAGGACA
GAGCTGAAGTACTCATACAGATTCGTTTGTGATGAGCATT
ACTACGGCGAGGGCTGCTCGGTCTTCTGCCGTCCGCGCGA
TGATACTTTCGGCCACTTCACCTGCGGAGAGCGCGGAGAA
ATTATCTGCAACTCCGGATGGAAAGGACAGTACTGCACAG
AACCAATCTGTCTTCCGGGGTGTGATGAAGACCATGGCTT
TTGCGACAAACCCGGTGAATGCAAATGCAGAGTAGGATTT
AGTGGAAAGTACTGTGACGACTGCATTCGCTACCCAGGCT
GCTTGCATGGCACCTGCCAACAGCCCTGGCAATGCAACTG
CCAAGAGGGTTGGGGAGGTCTCTTCTGTAACCAAGATCTC
AATTACTGCACACATCACAAACCGTGCCAGAATGGAGCCA
CTTGCACCAACACAGGCCAGGGAAGCTACACCTGCTCATG
CAGACCTGGCTTCACCGGGGACAGCTGTGAGATTGAGGTC
AACGAATGCTCCGGCAGCCCGTGCAGAAATGGAGGAAGTT
GCACTGATCTTGAAAACACCTACAGCTGCACTTGTCCTCC
TGGTTTCTACGGAAGAAACTGCGAGCTGAGTGCCATGACT
TGTGCCGACGGCCCCTGCTTCAATGGTGGACACTGTGCTG
ACAACCCAGAGGGAGGATATTTCTGCCAGTGCCCGATGGG
TTATGCTGGATTCAACTGTGAGAAGAAGATCGATCACTGC
AGCTCCAACCCTTGCTCGAATGATGCTCAGTGTCTCGATC
TTGTGGACTCCTATCTTTGCCAGTGTCCTGAGGGATTCAC
AGGAACGCACTGCGAAGACAACATCGACGAGTGTGCCACC
TATCCCTGCCAGAATGGCGGCACTTGCCAAGACGGACTCA
GCGACTACACCTGCACCTGCCCGCCAGGATACACCGGCAA
GAACTGCACCTCTGCGGTCAACAAGTGCCTCCACAACCCT
TGCCACAACGGTGCCACTTGTCATGAAATGGACGGTCGAT
ATGTGTGCGCTTGCATCCCAGGTTATGGAGGACGCAACTG
TCAGTTCTTACTCCCTGAAAACCCACAAGGACAAGCCATC
GTTGAGGGAGCCGACAAGAGATACTCTTACGAAGAAGACG
ACGGTGGTTTTCCATGGACGGCGGTTTGCGCTGGGATTAT
TTTAGTGCTTTTAGTGCTGATCGGCGGCTCCGTCTTTGTC
ATTTACATCCGTCTCAAGCTGCAGCAGAGGAGCCAGCAAA
TCGATAGCCATAGTGAAATCGAGACCATGAACAACCTGAC
CAACAACCGCAGCCGAGAGAAGGACTTGTCCGTAAGCATC
ATCGGAGCCACGCAAGTGAAAAACATCAACAAGAAAGTGG
ACTTTCAGAGCGACGGCGACAAAAACGGATTCAAATCGCG
ATACTCGCTAGTGGATTACAATCTTGTTCATGAGCTGAAG
CAGGAGGACTTGGGGAAAGAGGATTCTGAGAGGAGCGAAG
CCACAAAATGCGAGCCTCTCGATTCCGACTCAGAGGAGAA
GCACAGAAATCATTTAAAAAGTGACTCCTCAGAGAGGAAA
CGAACAGAATCTTTGTGCAAGGACACAAAGTACCAGTCAG
TCTTTGTTTTATCAGAGGAGAAAGATGAATGTATTATTGC
AACCGAGGTGTAACGCCACAACAGAGCTGTAGCTCATCTT
GTTCTACAGGAGGTTTTACTCCAGTAATGCTGCTCAAACC
AGAGGGAAGGTTCCCTTCACGTGACTGCTGCTGTGAAACT
AATGTTGAAGGTGATATTCAGAATGAGCTGGTTCTCAACT
GAAGTAAACACAGTGACTGCAGGAAAGGACGTTGGGCCAT
ACTGGCTCGGACTCTCAAAGTTTGTTTCCCAGGAACGTGC
CAAATGGACTTGCTTGCACTTCCTGTAGGGACGTTTTTTT
TTTACCTCATTGCACTATGATGGGTTGTATTTTTATTGTA
TTTAACACACAATTGAATCGAATACTGTGTATGCATATGC
ACTGACTGCAGTGTGCATCTGGAAGTTCTCGGATCATTGG
ATCGCGAGAGGAAGAACACTGCCATCAATGATGTTTGTAA
CTGATTCGTTGTTTTATTTCCGGAAAGCTTGTGTTTTCTT
TATTTAAATGTTATTTGTGATCGACGTGTTTGTGGTTTAC
TTTGTGTGTGTGTGTGTGAAGTTTGATATAATTTAAAATC
TTTTTTTCATTTCGCAGATATGTCTATTGTAAATAAGGCA
CTTCGGGTCGACGTGACTGTTCTCTGTAAATGTATTTAAA
CGTGCTGGTAAAACTTACAGGAGTTGTTTTTATGACTGTT
GTCCAATGAAAAAAAAATCACCTTAATATTTTTCCAAATA
AATCCTGTATGAAACTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dld-001 Contained in:
[Fosmid] CH1073-241D9 (1) (order this)
OTHER dld-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050446 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129159 (1) 3377bp
    GenBank:CU458992 (1) 2342bp
    CITATIONS (1)