Transcript

dhx38-202

ID
ZDB-TSCRIPT-110325-2549
Name
dhx38-202
Previous Names
  • dhx38-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050393 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050393|OTTDARG00000035412|ZDB-GENE-040426-1144 dhx38|OTTDARP00000039557 dhx38-001 LG_ CU469577.14 Danio rerio protein_coding KNOWN, 7502 bp
TGGGATAGTAATGGCGGCTTACTGTACACATTGTTGACGT
TTGCCGCTATGTTATATATTTCTTATTTTGCCACATCATA
CACTACTTCTTTTATACCACCGAGAAGCGTTTTGAGGAAC
ACATATATCTGACGTCCGAGGATATCACTGAAAAGACGCG
GTCGGCTGAGACCCATCTGCTGTACACTGTGCAGAGATGG
ACGATGATTCCTCCCTGCACCGGCTAGAAGGCAGTGACCC
CAGCGTTCAGGTCGGGGGTCTGATAGTGAAGAAGAAAAGC
GCTGCAGCAGAACAGCACGTGTTCAGAGCCCCCGCTCCAC
GCACCTCGCTGCTGGGTCTCGATCTGCTCGCTGCACAGAA
ACGCAAGGAGCGAGAGGGCAAGGAGAGGCTGGATGATCAG
CCCAAGAAATCCAAAGTGTCATCCTACAAAGACTGGGAAG
AGGGGAAAAGTGATTCGGGGTCTGATGATGAAAATCAGGA
GGATGGAGAGAGCAGGAACGGGAAAAAAGAAAGGAAGTAC
AGAGTCACTGGCTCAGAAACGCCTTCAAACCCTGGAGGAG
TCAGTGAGGAGTTCAAGAGGAAACACCAGCAGAGAGAGAA
AGACCGACGTGAACATGGGGTTTACGCTTCATCCAAAGAG
GACAAGAGCAAAGACAAGAACAGATCCAGAGACAGAGAGC
ATGACCGCCATCGGGACAGAGAGAGGAGGAAAGACAGAGA
TGAGCGTGAGAGCAGCCGCAGCCGTGGATCCTCTAGCAGT
CGCTCTGAGCGCAGTGAAGGCAGTGTAAGGAGTGAACGCT
CTCAGAGAGAAGGCTGTTCTGAGCGCATGAGCCGCGGAAC
CCGCCGCGAGGAGCCTGAATCACCCCGAAACAAACCTAAA
GACTTGGCCACTCCGTCGCGCTGCAGCTGGGATGAAGATG
ACAGTGGATATGCCAGTTCACGCCACTCCCACTGGGAGAG
TCCGTCTCCTGCCCCCTCACACCGGGAGAATGACCGCTCT
GAACGCAGCCAGCGCTCAGTGCGGGACAGCGAGAGAAGAG
ACAGATCAAGTAAACCTCAGTATCCTACCGATACTCCACT
ACCGACCCCATCATACAAGTACAACGAGTGGGCCAATGAC
CGAAAGCATTTTGGCTCCACACCACGTCTGTCCCGCGGGA
AAGGAGAGAAGAGAGAGGAGGGAGAGGGTGGCATCCAATT
TGACGATGAAGATGAGAAGGAGCAGTGGGAGGAAGATCAG
CGGCAAGCGGATCGAGACTGGTACATGATGGATGAAGGTT
ATGACGAGTTTCACAACCCACTGACATCCAGCTCAGACGA
ATATGTGAAGAAGCGGGAGCAGATCCTGCAGAAACAGACC
CAGAAACGCATCTCGGCACAGAAAAGACAAATCAATGAGG
ATAACGAACGCTGGGAGACGAACCGCATGCTCACCAGTGG
AGTGGTTCAGCGTCTGGAGGTGGATGAGGATTTTGAGGAA
GACAACGCAGCCCGAGTTCATTTACTTGTGCATAACCTTG
TGCCACCCTTCCTCGATGGGAGGATTGTCTTCACTAAACA
GCCTGAGCCGGTCATTCCAGTGAAAGATGCGACCTCAGAC
ATGGCCATCATCTCCCGTAAAGGCAGTCAACTGGTGCGAC
GCCACCGAGAGCAGAAAGAGAGAAAGAAGGCACAGCACAA
ACACTGGGAGCTCGCTGGCACCAAACTGGGTGACATCATG
GGAATCCAAAAAAAAGAGGATGGGGGAGACAGTAAAGCTG
TTGGAGAAGATGGAAAAGTGGATTACAGAGCCGAGCAGAA
GTTTGCTGATCACATGAAGGAGAAGAGTGAAGCGAGCAGT
GACTTTGCCAAAAAGAAGACTCTGTTAGAACAGAGACAGT
ATCTGCCCATCTTTGCTGTTCGCCAGCAGCTGCTCAACAT
CATCAGGGATAACAATATTGTGATAGTGGTGGGTGAAACG
GGCAGTGGTAAGACGACGCAGCTAACGCAGTATCTTCATG
AGGACGGTTACACCAGCTATGGTATGGTGGGCTGCACACA
ACCCCGCAGAGTGGCAGCCATGAGTGTGGCTAAGAGAGTC
AGCGAAGAGATGAACAGTAATCTGGGAGAGGAGGTTGGTT
ATGCCATCCGTTTTGAAGACTGTACATCAGAGAAGACAAT
GATCAAGTACATGACGGATGGGATTCTCCTGAGGGAGTCT
CTGCGGGAGTCAGATCTGGATCACTATAGTGCAGTAATCA
TGGACGAGGCCCACGAGCGCTCCCTCAACACTGATGTACT
CTTCGGGCTGCTTCGAGAGGTGGTGTCAAGACGCTCCGAC
TTGAAGCTTATTGTCACATCTGCCACCATGGACTCGGACA
AATTTGCGTCATTCTTCGGCAATGTTCCTATTTTCCACAT
TCCCGGCAGGACGTTCCCAGTGGATATCTTGTTCAGCAAG
ACTCCTCAGGAGGACTATGTGGAGGCGGCTGTGAAACAGG
CCTTGCAGATTCATCTCAGCGGGATGGTGGGTGACATCCT
CATCTTCATGCCTGGTCAGGAGGACATCGAGGTGACGTCA
GATCAGATTGTGGAACGGTTGGCCGATCTAGAGAACGCTC
CAGCCCTGGCAGTGCTGCCCATCTACTCCCAGCTGCCCTC
AGACCTGCAGGCCAAGATCTTCCAGAAGGCTCCTGATGGA
GTGAGGAAATGTATTGTTGCTACAAACATCGCTGAGACGT
CTCTGACAGTGGACGGCATCATGTTTGTGGTGGATTCCGG
CTATTGTAAACTGAAGGTGTTCAACCCTCGCATTGGCATG
GATGCGCTTCAGGTTTACCCCATCAGTCAAGCTAATGCAA
ACCAGCGGGCTGGTAGAGCAGGCAGAACAGGCCCAGGACA
GTGTTACAGGTTATACACACAGAGCGCCTTCAAGAATGAA
ATGCTGACCACCACTATTCCAGAGATTCAGCGCACTAACC
TGGCTAATGTTGTGCTTTTGCTCAAGTCACTGGGAGTTCA
AGACCTCCTGCTCTTCCACTTCATGGACCCGCCCCCAGAA
GACAACATGCTGAACTCCATGTATCAGCTGTGGATCTTGG
GTGCACTCGACAATACAGGCGCTCTGACACCCACCGGGCG
GCTCATGGTGGAGTTTCCTCTGGATCCGGCTCTGTCTAAA
ATGCTGATCGTGTCTTGTGACATGAGCTGCAGTGCTGACA
TCCTCATCATCGTCTCCATGTTGTCTGTGCCGTCCATCTT
CTACAGGCCAAAGGGTCGAGAGGAGGAAAGTGACCAGGTC
AGAGAGAAGTTCTCCGTGCCTGAGAGTGACCATCTGACCT
ACCTCAACGTTTACCTGCAGTGGAAGAACAACAACTATTC
CAGCATCTGGTGCAATGATCACTTCATTCACACCAAAGCC
ATGCGGAAGGTGCGTGAGGTGCGAGCTCAGCTCAAAGACA
TCATGGTGCAGCAGAAAATGAATCTGATCTCCTGCGGTTC
AGACTGGGACGTGATCAGGAAGTGCATCTGTGCTGCATAC
TTTCACCAGGCTGCTAAATTAAAGGGAATTGGAGAGTATG
TGAATGTGAGAACCGGGATGCCCTGTCATCTGCACCCCAC
CAGCGCTTTGTTCGGGATGGGCTACACCCCTGACTACATC
ATCTACCATGAACTGGTCATGACCACAAAGGAGTACATGC
AGTGTGTGACGGCAGTGGATGGTGAGTGGCTGGCTGAGCT
GGGACCAATGTTCTACAGCATCAAACACGCAGGGAAGAGC
AGACAGGAGAACCGAAGGAGAGCCAAAGAGGAGATCACCA
ACATGGAGGAGGAGATGTCTCTGGCACAAGAGCAGATCCG
AGCGCGGAAAGAGGAGCAGGACAGGAAGAACAATCTGGGC
AGCGTCAGGGCCGTGAAGATCTGCACCCCAGGAAGGAAAG
AGGAAATGACGCCGATGACGCCCAAACGAACGCCGGCCCG
GTTTGGCTTATAGTGCTCAGTTTCTACAAACGCATAATTG
CTTGCGTCAGTGCAGTTTTTCCTCTAATATGTATTCATCA
CAGTGCTTTTTCATCTTTGGCCAGCAGTAGGAGCAATTGT
ATAAGGAGAAAAATCTCTTCCTCCCTCTCACGGTGTTATT
TGTGGCTCTTTTTAACCATGTTTGGACTGAGATCTTACAT
TGAATCAGTGCTTAAATTGAAGTGAACACATTTGTTAGGC
TTGCATTTAATCTAAAACAACAAAAACAGCATAATTTGAC
ATTAATATGCATATTAGGCCCAATCATTCTCTTTTTTTTA
TATTTTATGTTTGTGTAAAACCAGAACTCTCGTGCTTATT
CACCTTTTTTCACCATGTCTGATCTGAAACAAAAACAACC
TTGATCTTACATTGAATCAGTCCTTAAATTGAGAAGTGAA
CACTTTTTTTATGCTTGCATTTGATCTAAAAACAACTAAA
AACAGGTTAATTTTACACTAATATGCATATTTACCCCAAT
GATTTCTTTTTTCTTTTAATTTAATGTCTGATGTGTTTGC
AAAAAAAACAAAAAAAAAAAAACTGCCGTATATATTCATT
TTTTTGACTGAAACTTAAAAAAAGATCTTATATTAAATCA
GTGTTTAAATTGAGAAGTGAACATAAAACCTCAAAACCAC
TTGAATTGATATTAAAATGCATATTTACCCCAATCATGTT
TTTCTTTTGTTTTAATGTTTAATGTGTTCGCAAATAACCA
GAACTGTTGGATTTATTCATTTTTATATACTGAAAATAAA
AACCTAGATCTTACATTGAATTGATGTTTAAATTGAAAAG
TGAACACATTTGTTAGGCTTGCATTTAATAAAAAAACAGA
TTAATTTCATATTTATATGCATATTTAGCCCAGTGATTTA
GATATTTATTTTATTTTAATGTTTGATGTGTCTACAAACA
ACCAAAACTGTTGCATTTATTAAATTTTATAGACTAAAAC
TAAAAGAACCTAGATCTTACATTAAATCAATGCTTAAATT
GAAAAGGGAACACATTTGTTATGCTTGCATTTAATAAAAG
AGCAGCTTAATTTGACATTATATGCATATTTAGCCCAGTG
ATTTAGATATTTCTTTTATTTTAATGTTTGATGTGTTTGC
AAAAAACAGATGTGTCGAATTTATTCATTTTTTGGGACTG
AAACTAAAAGAAACTAGATCTTGCATTAAATCAGTGTCTA
AATTGAAAAGTGAACACATTTGTTATGCTTGTATTTGATT
TATAAAATCCCAAAACCGCTAAATTTAAATATCAAATGGC
ATATTTAACCCAATCATGTTTTTCTTTTGTTTTAATGTTT
GATGTATTTGCAAATAACCAGAACTGTCGCATTTATTCAT
TTTTATATACTGAAAAAAAAATCTAGATCTTACATTGAAT
TAATACTTAAATAAAAAAGTGAACACATTTATTAGGCTTG
CATTTAATATAAAAAAACAGCTTAATTTGACAATAATATG
TATATTTAGCCCAATCATTTTCTTTTTCTTTAGTTTTAAT
GTTTGGTCTATTTGCAGTAAACCAGAGCCGCCGCATTTAT
CACATTTTATAGGCTAAACCTTAAAGACAAACTAGATCTT
ACATTGAATCAGTGCTTACATAAAGTGAACACATTTGTTA
GGCTTGCATTTAATCTAAAAACAACCCAAAACAGCTTAAT
TTGACATTAATATACATGCATATTTAGCCCAATCATTTTC
TTTTTATTATAATTTAATGTTTGACGTGTTTGCAGTCAAC
CAGAATGGTTGCATTTGTTCAATTTTATAGACGGAAATTA
AAGAAAAACTCGATCTTACATTGAATCAGTGCATAAAATG
AGATGAAAACATTTGTTTTTGCTTACATTTAATCTAAAAC
CCCCAAAACATCTTAAGTTGACATTTAATATATGCATATT
TAGCTCAATCATTTATTTATTTTATGGTTTGATGTGTTTA
AAAAAAAAAAAACAGAACTGTCGCTTATTCTAGTTGTTTT
GTTTTGTTTCAGTCAAAAAAAAACCACATCTTACATTAAA
TCAGTGCTTAAATTGAAATGTGAACACATTTGTTAGGCTT
GCATTTAATCTAAAAACAACCCAAAACAGCTTAATTTGAC
ATTAATATACATGCATATTTAGCCCAATCATTTTCTTTTT
ATTATAATTTAATGTTTGATGTGTTTGCAGTCAACCAGAA
TGGTTGCATTTATTCAATGTTATAGACGGAAATTGAAGAA
AAACTCGATCTTACATTGAATCAGTGCATAAAATGAGATG
AAAACATTTGTTTTGCTTACATTTAATCTAAAACCCCCAA
AACATCTTAAGTTGACATTTAATATATGCATATTTAGCTC
AATCATTTATTTATTTTATGGTTTGATGTGTTTAAAAAAA
AAAAAAACAGAACTGTCGCTTTTATTCTAGTTGTTTTGTT
TTGTTTCAGTCAAAAAAAAAAACACATCTTACATTAAATC
AGTGCTTAAATTGAAATGTGAACACATTTGTTAGGCTTGC
ATTTAATAAAAAAAAAAAAAACTCCAAAACAGCTTACTTT
GACATTAATATGCATATTTAGCCCAATCATTTTCTTTTAT
TTTAATGTTTGATGTGTTTGCTAAAAAATGAAAAGTCGCA
TTCATTCATGTCCTCCTATACTATTCACTTTATCGTTGCA
TCCTAATTCGCATTCTCTCATACTTCAGCTTGTGAAACGC
AGCCGTTGTATCTTTCTTTCTTTCAAAAAACACAGAGCCT
CCATGAATATTAACTTCCTGTACTTTGATAGGTTAATCCC
CTGTGGACGAAGCACGTCTTTGTTATTCTGACAAAAACAT
TGCTCGAATATTTCATCATTCTACCGGAATCAACACTGAC
CAGCGGCGGTCAAATCCTGTGTCGTCTTTGATGCAATTGG
GCTGCAAGTCGCTGAACAGATGTACTGTGTGCCGACAGAG
ATGACAGGCCTCGACTGCTGTGAATTAAACAGAAAAACAA
CAACAATCTTTCACTGAGGGTCATTTCACCTCCTCGCTCC
GCTACTGTTTGTATTTTTAGAAACGTACTGATGTGTACAG
TATATGTGTATATTGCGTTTGCTTTTTCGTTCTTTATTTT
AAATCATTTCGATATGTCAGAGCGTTTAGGAAAATTACTG
TATTTTTGACGTGTATTTCACTTTTACCATTTTATATTCG
ATATTAAAGCAATGAACGCATCTGTGCTTTGTTGCGTTTG
CAAGGTGGTGACCAGATCACTGAGTGTAAATTAATGCAAT
TTGATGCATTTCCTTAATTAGTGGCCATTCTCATGGGATA
TGATTGTGTTTTTCATTTAATTTAAATGTAAATATGCAGT
AAATTGACATTTTTGACATTTACGCTTGTAAAACATGGCC
ACAGCCTCGGGGGATGGATTGTTTTGTTTTGTTTTTCCCC
ACTACTGTTTGTTAAGTTTGCATTTAATGGTAATAAATGC
GAAACTTGTAATGTGCATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations