ZFIN ID: ZDB-TSCRIPT-110325-2474
Transcript Name: odr4-202
Previous Names: c1orf27-001, c2h1orf27-001, ch73-147d18.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050093 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050093|OTTDARG00000035237|ZDB-GENE-080502-1 c2h1orf27|OTTDARP00000039322 CH73-147D18.3-001 LG_ CU570979.21 Danio rerio protein_coding NOVEL, 1659 bp
GTCCATTTACTACTGCTGTGAGAGCTCATCAGCTGTTTGG
AGAAGTGTGCATGATCTGAAGGCAGAATGGGAAGGAGTTA
CTTCGTAGATGAAGCTGTAGAGGAATACCTTAGTGGTCTT
CAGGCAGCTCCTGGATCATGTGTCACAGGACTCCTCGCTG
GTCACTCGTCTCCTCAGAGGGATTTTGTGGTGTTAGCAGT
GCAGACTCCTCACAGGGAGAGCGAGGGGCAGACAAAAGCT
ACAGCTGGAGGAAGTGCACTTGATGATATTGATGTGGCGT
GGCTGACAGAACATGCCAAGCAGGTGTCTCGCATGCTGCC
GGGAGGTCTTTGTATTCTTGGCCTGTTTATAGTAACTCCG
CCTGAACTCTCCAAAGATGCCAACAACACTTTAAAAAGGC
TTTTATTTGCCATGGATAAGTACATAACTAAGGGAAGACT
GTGGGACCTGTCAGAGGAGGACGTGACTGAGCGAGTCACC
CTGCACATCTGCTCCAAAACGAAGAAAGCTGTCTGCAAAA
CATTTGATGTAAAAGATCCAAAGAGTTCGGCCAAGCCAGC
AGACTGGAAGTATCAGACAGGAGTCTCTTCACCCTGGCCT
ATGCTAACCTGCTCTGTTGAGGTGGATCTGCAGATCCCTC
TCATAGGATCTTCCTCTAATAACATAGAAACTTGCATGAA
GGATGGTCTTATGAGGTGGGCTAAACAGATTGAGGCTGGT
TACTGTCTCATAAGTGGCAGACAGGCATTAGATGACACTG
AACTCTTCATAGGACAGAAAAAGAACCCAAAGACAAGCCA
TCGTCAGATACTACCTGTGCGGATCCTTGTCTCAAATGTG
AATGTGGACGAGCGGTGCAGTGCTGTGGTTCAAGTGTGCA
GTGGCTCCATGAGAGTTCGAGGAGTCGTTCACTGCAGGGC
TTATATAAACAGCAACAAACCTAAAGCCAGACATGCAGTG
CAGGCTATTAAAAGAGACATCATAAACACAGTTTCCTCTA
GAGTGGAGATGTTTCTAGAAGATCTTTTAATGAGTGAAGG
GAGTCACAAAGGTCTTTCCACTGGCCAACAGGCTCTTCCT
CGCCGTGTGTTTGCCCCAATGCCCTTTTCCAGCCTCTCTG
TGTGTGACTACATGTTCCCAGATGAAAACACAGCTGATGT
GGCGGAGCGTCTGAAAGAGATGCTGGACTGTGAAACACCA
GTAGAGGACATAGACATCAGTCTGGAAAGCAACCAGTTAC
TTTCCACTGGATCAGTGATAACTGACAGCCACAGTGATGA
TTCCAATGAACATATCAACTCAGTAGTCCAAGATGAAAAT
CTCAAAATTCAGAAAGCACCGCAATACTATGCTGGTGTTG
CAGTATCAGCAGCCATTGCTCTCCTCGCCACGGCCGTATC
TCTGCTGTATCTGAGTGAATGAAAATGAAAATATTGAATA
TGTTAGCATGAGTGTACAAGTGAGTATGTGTAATATACTG
TGTGATCTTAAAAAATGATTTCAAGTATAATTCTTAAATA
GAGCCATTATATTGTAAAAAAAATATATATATACACATAC
AACTATTTGACAGTCATTAACACTACACAAGATTTACCTT
CTCACCTCACTGATGGCTTCATTCTTTTGACATGATTTGA
AAATAAAACATTAAGGTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
odr4-202 Contained in:
[BAC] CH73-147D18 (1)

Genome Resources: Vega_Trans:OTTDART00000050093 (1),  Ensembl_Trans:ENSDART00000150086 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC056799 (1) 2131 nt
GenBank:EG566098 (1) 879 nt
GenBank:EH486558 (1) 878 nt
CITATIONS (2)