Transcript

mfap4-201

ID
ZDB-TSCRIPT-110325-2457
Name
mfap4-201
Previous Names
  • mfap4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049978 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049978|OTTDARG00000035160|ZDB-GENE-040426-2246 mfap4|OTTDARP00000039224 mfap4-001 LG_ FP017168.5 Danio rerio protein_coding KNOWN, 990 bp
ACACACGGTGAGTGACTTATTCTGTAGAGCGGGATTATAC
GAAGAAATAACCTGCAACAATAAGAAGGTGTGAGTGAAGC
TCTTTTACATCTCTTGTAGATAAACTGAGCTGTTGAGGAG
AGAGTGAGAAGATGGCAATCGTGCTGTTCTTGGCGACGCT
TCTCTCTGCTGCTTTGGCCAGTGACTGTACATCCATGCCC
TTCGACTGTTCTGACATCTACAAATCAGGAGAAACTCTCA
GTGGGGTTTACACCATCTATCCAGCCGGGGAAACTCCAGT
CTGGGTTTACTGTCAGATGCTCTCAGATGGGAAAGATGAA
GAGAACGGAGGATGGACGGTGATTCAGAGGAGGATGGACG
GCAGTGTGAATTTCTATCGGCCGTGGAGAGACTACAAGAG
AGGATTCGGGAATGTGGAGGGAGAATACTGGCTGGGACTA
GAGAACCTCTACCAGCTGACACGCCACAAGAAGTTCATGC
TGAGAGTGGATCTGGAGGACTTTGAAGGAAGGAGAGGTTT
CGCTCAGTACTCGTCCTTCTCTGTGGGTTGTGAATGTGAA
GGATATAAACTGCAGGTTTCTGGATTCACTGATGGAGGAG
CAGGCGACTCTTTATCTGGCCATAATGGTGTGAAGTTCTC
CACTTTTGACAAAGACCAAGACACATATGACAAGAACTGC
GCTAAAGAGTTTCTCGGGGCATTTTGGTATGGATCCTGTC
ACACTACAAACCCTAACGCTGTGTATTTATGGGGAGAAGA
TGCCACCCATCATGCCATTGGCGTTTGTTGGTACACCTGG
AAAGGCACTCACACTGTCAGTATGAAAATCATCAGCATGA
AGATCAAACAAATGCCTTAGAAACATGATGAAGCTTTTAA
AAGGGAAATCTCTTCTGGGTTTCCTTCCTCTTATTATTGT
GTAACTCAAAAGTCATGTCTTTGAAATGTATGGCTGTTTT
TTTTTACTCAATAAAGCTTTAATAAACTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations