ZFIN ID: ZDB-TSCRIPT-110325-2369
Transcript Name: arl8a-201
Previous Names: arl8a-001, ch1073-204j4.2-001, si:ch1073-204j4.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049564 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049564|OTTDARG00000034910|ZDB-GENE-030131-5025 arl8a|OTTDARP00000038883 CH1073-204J4.2-001 LG_none CU539055.9,CU855848.15 Danio rerio protein_coding NOVEL, 2734 bp
GCTGTGCGTGGATGTGAAACCCCACCCAATGAGGAAGGAC
GAGCCGTGAGAGCAGCAGCAGCAGGAGCCCGCAGACCCGA
GCCGACCGACCGCACCATGATCGCGCTATTCAACAAGCTG
CTGGACTGGTTCAAGGCGCTCTTCTGGAAAGAGGAGATGG
AGCTGACGCTGGTCGGCCTGCAGTACTCCGGGAAAACCAC
CTTCGTCAACGTGATCGCGTCTGGTCAGTTCAGTGAGGAC
ATGATCCCCACCGTCGGCTTCAACATGCGCAAGATCACCA
AAGGAAACGTCACCATCAAGTTGTGGGATATCGGTGGTCA
GCCGCGCTTCAGGAGTATGTGGGAGCGTTACTGTCGTGGC
GTCAGCGCTATAGTGTACATGGTGGACGCAGCAGATCCAG
AGAAGATCGAGGCATCGAAGAACGAGCTGCACAACCTGCT
GGACAAACCACAGCTACAGGGCATCCCGGTGCTGGTCCTC
GGCAACAAAAGAGATCTTCCCGGAGCTCTAGATGAGAAAG
AGCTCATTGAGAGAATGAATCTGTCGGCCATCCAGGACAG
AGAGATCTGCTGTTACTCTATCTCCTGTAAAGAGAAGGAC
AACATCGACATCACACTACAGTGGCTGATCCAGCACTCGC
GGACCCGGCGGAGCTGAGGGCGAGGCGTCTGATTGGAGGA
GCTGCGTCATGTGATCAGCTGTATTCCATTATAAACAAAC
GAGCATCCGCCCCTCCCCCTCTGTTCTGATAAACTAATCA
ACATCATGTCCATCGTTTGATTTTTCAGTTTTTACTTGAA
TGTGCTTTTTTACGGTTCGTCATGACGTGTTTGGTCTCCT
CGCGTGCGGCGTTCTGCATGTTTGGGAACGAACCAGCGCT
CGGCAGTACGTTCGCGCCAACCTTGTTGTTTTAATGTTAT
TCCAGCGTTCCCAGAACATTCCCAGAGAATCTGCTGATTG
TACGCATTTAACGAGATGGTGAATCTTAGCATCGTTAGCT
TATGTGTGCGATCTGGCGATTATAACATCACACTGTTAGC
CAAGGTCACATGGTGTGCGTAAAATCTTGTAGCATAACAA
AATCTGTCGTTTTATCGGAAAGCACACGAATCAGTCCGAA
TGAAGGTTTTATATGTTTTCTTTGTGTCGCCGTTGCGTGC
AGAACAACATCAGTGTTTAGACGATTCTTTGATCCCCGAT
TGTTCGTGAAACCATATCAGACGGCAAACGCTGATCTGTT
TCTGTTCGTTGCGCTAATAAAACCGAATATCGTGCGAATC
TCTTGGTTCCGAACGCTGTTCATATCGGGGAGAAATGAAG
ATCTTGCCATTGTTTTTTCCGCTTTAATTTTGTTTACAGC
TTGTTTCGTTTTTGTCGCACATGTGGACGTTTTTGGCCTA
AATCATAACGATTTATAAACACGTCAGTAGTTTATACATA
TGTAAATTGACATATTTTTTCATTCTTTATTTGTTTTTGG
CATGTTTTTACTCATGTTTTTCAGTGTTTTTCAACTGGAT
TATGTAAATAGCAACTTAAACCAAATGAGATCTCCCCTCT
GAGCATTACAGTGTTTGTCTTATTGTGATTAGCATCCTAC
GATAATAATAATTATAATAATAATAACAATAATGATATTG
AAGAAGACTCCACTCATATTCACAGCAATCTGAATGAGCG
GATTGTGTGTGTGAGCGATTGTGTATGTGCGCGCGAATGC
CGTGATGTAGACTTGAATAATATTTACGTTATAAATGCCG
CAGGTTTTTTCTGTTGATTTTGCGCAACTGCTAATCATTT
TGTATTCATCTGCACTAATAATTTGATTTTCTGCGTACCA
TGAGTTCATAATCTAGATGAGTTAGAACACACAAGACGAC
AAATCGGCATGGCTAAGCTTAAAAGTGGATGTAGCAAATT
CATGTTACGACCCACGTTACAATGGTAGTTATTTTTATTA
AAACTGCTAACATTTTAGCATTATTGTCGTTGAAAAGCGA
CAACATAGGCATTTACGAAGTCAACGAAATTGATGTAAAA
CAAAATTCGAAGTTAGCCAAGTGAAGTTTGTAATTCGTTA
CAAATTCGTTATCATCATAAATTGCTTTAAATGTAATAAA
ATTTATAAATTTGTTGATTTATAACAATGTAATTAATTAA
GTCATATTCATGGCATGCAACTTTGTTACATTGTTAGTTT
CTAAGTGCCCTTTATGTCATAAAATGATACATTTTTAAAT
TATAGTTGGCCGACTGTCATTTTGTCGTGTTGCGCAAGTC
GATTTGACACTAATTGCAGAACACTAGATTTTCTGCTCTC
ATTCATCGTGACTTAAGCTCATCTGGCCTCTCGTGACATC
AGTATGTGTTTATTTGAATATTTTTGTGTGTACTTAAATG
TGGCCAAAAGTTTTTTTGTTTTGATATGTTGGGATTCCAC
ACTGGTTTCCCGTTGCATGGCTCATTATGGGATGGAGCAG
GTTGCCATAGTTACTGTATAATCAGAGTGTGATTGGACTG
AGCTCAATGACGTTTTTTTTTGCTCCTGTTTATATATGGA
CCCCACAGTACCTTTTTAAAGCAGTCACATAACTACAGTT
TCTGTACAAGACTCGATCACTTGAGTTTTACATTCGGGAT
CTTTCTATTCTCTCGTACTCGCGGTGATAACTGTACATGT
TGTTCTTGTTATTTACAGATTATTTAAAAATGAAATTAAA
TGATTTCCCTCTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arl8a-201 Contained in:
[BAC] CH73-379E9 (1)
[Fosmid] CH1073-204J4 (1)

Genome Resources: Vega_Trans:OTTDART00000049564 (1),  Ensembl_Trans:ENSDART00000149320 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC056568 (1) 2716 nt
GenBank:EB936022 (1) 495 nt
CITATIONS (2)