Transcript

chrnb3b-202

ID
ZDB-TSCRIPT-110325-2361
Name
chrnb3b-202
Previous Names
  • chrnb3b-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049539 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049539|OTTDARG00000034889|ZDB-GENE-030102-4 chrnb3b|OTTDARP00000038859 chrnb3b-002 LG_ CU459160.5 Danio rerio protein_coding KNOWN, 645 bp
GGATTCTCTTCAGGAGTCAACCTCCGCTTTTCCTGCAGTT
TTCGCGGCAAACAACAAACTTTTATCGCTTGTTATGAAAA
GTTGTTTTTAAACAGCAGCCAGTGCGTTCAGATTCATTTG
AGTAAGAGTCAGGTCAATTTTTAATACTCCCTCCTGAAAT
GACGCTGACAGTCATTGGTCTTTTTACCTTGTTTACCAGC
ATCTTCGCCACCACGCCTGTTAAGTGCTCTTGTCCTCATT
TGAGGTCAGTAAACAGTTTGTGGAGGACACACTAGAGAGT
TTGTATCTCTGGCAGAAAGAGAAGATGCTCTGCTCAGGGA
CTTGTTTCAGGGGTACCAGCGTTGGGTCAGGCCCATTCTG
CACGCAAACCACACTGTGAAGGTGCGCTTTGGCTTGAAGA
TCTCTCAGCTTGTGGACGTGGATGAGAAAAACCAGCTCAT
GACCACTAATGTATGGCTGTATGAGGAATGGCTGGATTAT
AAACTGCGCTGGAACCCTGAGAATTATGGTGGGATCACAT
TTATCAGAGTCCCGTCAGAGAGCATCTGGCTCCCAGACAT
CGTTTTATATGAAAACGCAGACGGACGTTTTGAAGGCTCG
ATCATGACCAAAGCCATCGTGAGATACAATGGCCTGATCA
CCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations