Transcript

si:dkey-19a16.13-201

ID
ZDB-TSCRIPT-110325-2327
Name
si:dkey-19a16.13-201
Previous Names
  • dkey-19a16.13-001
  • si:dkey-19a16.13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049431 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049431|OTTDARG00000034830|ZDB-GENE-110411-2 si:dkey-19a16.13|OTTDARP00000038775 DKEY-19A16.13-001 LG_ AL928685.7 Danio rerio protein_coding KNOWN, 612 bp
GTTTTCCAGGTGTGTTTGGCGAGTCTGTGTCAGTGACAGA
GGGAGATTCGGTCACTTTACACACTGATACTCAAACATCT
ACAGATGACATAAGATGGACATTTGGAGCTGAAAACTCTC
TCATCGCTAAAATTAAAATAAAGAAGCAAAACCTCTCCAC
ATATGATGGTCCTGATATGAGATTCAGAGACAGACTGAAG
CTGGACAATCGAACTGGATCTCTGACCATCATGAACATCA
GATCTGAACATGCTGGAGATTATAAAATGCAGATCAGTGG
AGAAAAAATTATAATAAAAACCTTCAGCGTTTCTGTCTAC
GCTCGTCTGCCTGTTCCTGTCCTCATCTTTAACTCTTCTC
AGTGTTCTTCCTCCTCATCTTCTTCAGTGCAGTATTGTTC
AGTGTTGTGTTCAGTGGTGAATGTGAGCGCTGTGAGTCTC
TCCTGGTACAAAGGAAACAGTGTATTGTCCAGCATCAGTG
TGTCTGATCTCAGCATCAGTCTCTCTCTACCTCTGGAGGT
GGAATATCAGGATAACAACACTTACAGCTGTGTGATCAAC
AACACCATCAGCAACCAGACCACACATCTGGACATCAACA
CAGTCTGCCAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations