ZFIN ID: ZDB-TSCRIPT-110325-2311
Transcript Name: si:ch73-334e23.1-002
Previous Name: ch73-334e23.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049377 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049377|OTTDARG00000034801|ZDB-GENE-110408-36 si:ch73-334e23.1|no_translation sox2ot-002 LG_none FP102167.4,CU468686.12 Danio rerio sense_overlapping NOVEL, 400 bp
CTACAGCTTGGACAAAAGTCTATAGCCAGTGCATTCCTAG
CTCCCCTTACACAGAGAGGCAGACACAGTCAGAGAGAAGA
CGCGCCGGGTCTCGGCTCGGCTCTCCTCTGTTAGCAGGTG
AAACGCTGGATATCTATGGGTCTTGGGGCCTGCAGGAAAT
GGCAGGCAGTGGGAGGCTAAAAAGGCAAGATGGCGTGGAG
CTGCAGAGGGGCTGAGGCGGGTGAGAGCAGCCGCGCTGAG
AGCACTCTGAGCGGGCACACGGAGCGACTGGACGCTATGG
ATCATGAGAGCGGCTGCCGGAAAACTGCGCGGCCGGAAAA
AGCGACTCCTCGCTGGGCGCGCATGGGAGGATCCGGCCGG
CAGGCGCGGGGAACTTTTGGATGTGTCAGTCAAAGTGAGT

si:ch73-334e23.1 TRANSCRIPTS
Type Name Length (nt) Analysis
antisense si:ch73-334e23.1-001 (1) 504
si:ch73-334e23.1-002 400
si:ch73-334e23.1-003 (1) 503
si:ch73-334e23.1-004 (1) 522
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-334e23.1-002 Contained in:
[BAC] CH73-242D14 (1), CH73-334E23 (1)

Genome Resources: Vega_Trans:OTTDART00000049377 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB947627 (1) 622 bp
GenBank:EB955887 (1) 591 bp
GenBank:GO599877 (1) 455 bp
CITATIONS (1)