Transcript

il12rb2-202

ID
ZDB-TSCRIPT-110325-2167
Name
il12rb2-202
Previous Names
  • il12rb2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048914 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048914|OTTDARG00000034555|ZDB-GENE-080107-3 il12rb2|OTTDARP00000038385 il12rb2-001 LG_ BX323033.6 Danio rerio protein_coding KNOWN, 1821 bp
ATGCATCTTGCAGGAACTGTATGCACCGTAAGGTCAAGCA
CAGGCAAAGAAGTTCTCTTAGGTTCCAACTTCACCGTCTC
CTGCATCTTCAACAAGCCATGCACTAAACAATTGTTTCGG
AATAATGAGCCAATCAAGTATGAGCTATCTCCCAGGTCAA
GAGAGGTGTTTGTGTATATTAGGAATTTAACAACGTTGAG
CATCTTTACCTGCAAGTGTAATGACAACCCAGAGCCTTGC
GGAATTGACATCACTCCAGGATACCCTCCAAACTTTCCGC
AAAATCTCACCTGTATACGAAAAACGGAATTTGGCAATGT
TAGTTGCACTTGGACAACAGGAAGGGATACCAAAATTGTG
ACCACATGTCAATTACGGGTTCAAGGTGATCCACACCATG
GCTATGAGAGTGTTATGAACTCTTCAGGATTTTGTTGGGC
CACATTCCCTATCAAAAGCCGAATGTCACAACTAACTGTG
TCACTCAATGTCTCTAATAGCCTGGGCTCAAATACCTCAG
TACAACCATCATTACCGAAAATCAAGCATGTGGACTGCTC
CTCCCGATGGTGCCACCTACACACTGACAACCACAGCATG
AACTTAGTGGAAGTCCAATACAAATCGCCAAAAGGCATCT
GGAAGAAAGTTCAGATCAATGGTAAGAAAAGTTTAAACAT
ATCCTTGCTGGAGCCATATACAAAATACATGTTTCAGATC
AGGAGGAAAATAAACCAAACCATGGGTCTGTGGAGTTACT
GGAGTCAAGCAAAGGAAGCAGAAACCAAAGAAGAAGCTCC
TGACAAGGTCCTTGACTTCTGGTACCTCCGAGAACTGAAA
CCTTCACAAAGTGAAAAGTGTTTCCGCATATTTTGGAAGG
AATTAAGTGTGTCAGATGCCAAGGGGAAAATCCATCAGTA
TGATATAACTGTGAAGAAGGGGAACTCAAGAGAAATCATT
GTAGTTCCACGCCGAATAAATGAGAGCATATGCTGCTCTG
ACTGCTCTGTTTCAGTCTCCGCAGTGAACTCAATGGGTCA
ATCTCCTGAAAATTTCATTAAGCTTCAGACTCCACATCTC
GTTTCAGGTTTCCTGTCCCATAAGTCATTGAGCAATCATA
GCATTGCCCTCTCCTGGCCGAGGCTTGCCATTGCAGGCAA
TATAACAGAGTATGTGGTGCATTGGTATCCTGTTGGAGAC
ATTGAAGAGATTCAGTGGATTAGGGTGGTGGACACGAAAG
CCAATATTACCGGTCTACGGCCTCAAGAATGCTTTCAGGG
TGCTGTTACAGCTCTGACCTCAAATGGTCCTGTGGCATCT
AATAAAGACCTCTCCACATGGCAGTCAGCTCCAGAACAGG
GTCCGGTTCCTCAACAAGTGAAGAAGAAGACTGAGAGTTT
AATAGTAAAATGGTCTAAAATTCCTCAAGAAAAGAGAGGA
GGCTGTTTGAAAAAATACACAGTCTACTTGATGGACAAGT
CGAAGGGGGAAATACACCATTACAGTGTGGACTATCCATT
GACAGAGTATATCATCAGTGGTTTGTCACCTGGGCAGTGC
TACAATCTGTGGGTCACGGCCTGGACAGATGCTGGAGAGG
GACCCAGAGGAAGTGATCTCCCATTCTGCACACCAACAGA
TAAGAGACTACTTTCCCTTGTGATCTTGGCTGGTGGAGCA
GTACTCTTTTTCTGTCTTTTCCTCATCTGCATCTGTCAGT
TCTCCTCTGTTCAGAGACGATTCCTAAGTTGTTTCCAGTG
TCTGCTGCCTAGAGTTATTCCAGATCCAGCAAACAGCAAA
TGTGCAAAGACTTATGACAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations