ZFIN ID: ZDB-TSCRIPT-110325-2130
Transcript Name: nos1apa-203
Previous Name: nos1apa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048757 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048757|OTTDARG00000034463|ZDB-GENE-081024-1 nos1apa|OTTDARP00000038261 nos1apa-001 LG_none CR855385.7,CR936445.5,CR385065.21 Danio rerio protein_coding KNOWN, 2804 bp
CTCAGCTTGTATCCACATAGAACCGCTCTCTGCCACTAGG
TGTCATTCTCCGCTCTTCCTGCACGCCACTGTTGGGTGTT
GAACGTTCGCGAGGTGTCTTTCTCCTCCTCCAAACCTGTG
ATGAAGCCGTGTTCCAATGAAAGCAGGTGGAATTCCCCCT
TTCAGCCAATGGCGCTCTGCCCTCGCAACAATCCTTTCGA
AAAAGGATGTGTGGGCTAGGTTATGGCGCTGGCGTGAAGT
TGTTGGAAACGGACAAGCCCAGGAAGCAGGATTCTGGCAC
TGCCACACCAGCTAAAGCTTAGGGCTGCCCTCTTGAATGG
GAAAGAGTGGGCAGATCGTTCACATTTGATCAAACGCAAC
ACCTAGTGGAATTCACTTCGGCGACGTCGGGTTGAAAATA
GTGATTTCTACAAAAGTTGCTCTGTCAAAAGCAAGCACGC
CTGGGAAACCAAGAGTTACCTCGGGCTAAAACAAGACATG
GACCGCAAGAGTTAGACTGAGTTCTGGCTCCCCCCGAGCT
GTTTGTGTTTTTTAACCGAGGAGAAAGACCTAAAACAGAC
ACCATGCCTGCAAAAACAAAGTACAATTTAGTCGATGATG
GACACGATTTACGGATTCCTTTACATAACGAGGAAGCCTT
CCAGCATGGCATTAATTTTGAAGCAAAGTATATTGGTAGT
CTGGATGTGGCTCGACCGAATAGCCGTGTGGAGATTGTTG
CGGCCATGAGGCGAATAAGGTATGAATTTAAGGTGAAGAA
TATCAAAAAGAAGAAAGTCAACATCATTGTGTCTGTGGAT
GGAGTAAAAGTAGCCCTGCGGAAAAAGAAAAAGAAAAAAG
AATGGACCTGGGATGAAAGCAAGATGATGGTGATGCAAGA
CCCAATATACAGGATATTCTATGTATCGCATGACTCCCAA
GATTTGAAGATCTTCAGTTACATAGCGAGAGATGGCCAGA
GCAATGTGTTTCGGTGCAACGTCTTCAAATCGAAGAAAAA
GAGCCAAGCCATGCGGATAGTGCGGACGGTGGGTCAAGCC
TTTGAGGTCTGTCATAAACTTAGCCTTCAGCACACACAGC
AAAACGCAGACGGCCAAGAAGACGGCGATGCTGACAAGAC
ATGCACAGACTCTGGAGTAGCAGGGCGGGAGCTCACGGGG
GCCGAAAAGCCTGCTGCAGATGAGACTGACATTGATGCAG
AGGAGCTTCCCCTCCCCGACAGCACAATGGACGAGTTCAG
CCGCGGAGTCACTGACCTGGATGCGGCCAAGAAAGACGAA
GACGTCAGCAAGGACAAAAAGCCCTCGGAGGAGCCCGTGA
TCCTGCTGGCATCCCCTAAATTGCTACTACCGTCAGGCAG
TGATCTCCCGTCCAGCACACCGCTGTCTGTGCACCACCAG
CTCCAGCTTCTCCAGCAGCAGCTCACCCAGCAGCAGCAGC
AGACACAGGTGGCCGTGGCCCAGGTTCATCTGCTGAAGGA
TCAACTCTCTGCTGAAGCGGCAGCGAGGATTGAAGCCCAG
GCTCGAGTTCACCAGCTGCTGTTGCAGAATAAAGATCTCC
TCCAGCACATTTCCCTGCTGGTCAAACAGATCCAGGAGCT
GGAGCTCAAGCTGGCTGGACAAGGCTCTATGGGCTCTCAG
GACAGTCTCCTGGAGATCACCTTTCGTGCCAACGTGCCCC
CAGTCTTATGTGACCCCAGCACCCCTCGACCAGAGGACTC
CATCCTGCCTCCGCTGAACGATGGGACACAGCTCTCCCTG
CCGCTCTGCAGTCCTATAGGTAGGGACCAGGGTTTGATCA
AATTTGAGTGTTTTCGCTTTCTGCCTGGACCGCCACACCA
ACAGGAGGAGGACAGTCCCGACACGCCGTCTCAGGACGTC
TCGTCCTCCTCCCGAGACGAGCTTCTAGGCAGTCTGGAGC
TGCTCCGGTTCCGTGAGTCTGGCATTGCATCCGAATACGA
GTCCAACACAGATGAGAGCGATGAAAGTTGGGGCCTGCAG
GATGAGAGCAGCCTGCGCCTGCTCAATGTGCTCAACAAAC
ACATCCCGTCTGACTGCCTGGATGACGAAATTGCTGTTTA
ATGTGATTTTGTGCTCACGGCTTGGAAAAACTCTGCTCGA
CGCTCTGCTTAAATGGTTTGAGTCAGTCAGTGTTAATATT
GTCTGTTTGTGCTGCTCATTCTGGGAGACTGAGGTGACTT
TACTACCTTGGTGGTAGTTTTGTTTGTTATGTTTTAAGTC
ATATGTTGAAGACCAGAAGGTCTAAAAGTGTAGCCAATGC
TGTTGGAAACACTTTACTTTAGGAAGGCACATCAGAGTTT
TTCTTATGGGACGTTCACACATTCAGCGATTTGTTATGAT
GAAGGTTGCCAGGTCAAAGTGTTGTTGGTTATAATGGGGT
CCCTATTTCCAAAGTCTATTTCCAAAGGCAAATCATTTCA
CTTCACGGCCATATTTGAAATGCCTCTCAGGCGTTCGAGT
GCAGCTCCTACCTGTTTAAATGGGAAACTTCACATTCTTC
AAAACTGTTTGACAAGTTTATGATTAAGTTAATTATTTGC
TGTCATCAATGAAATTTAAAAACAGCTGTCTCATTTCAGA
AATAAGCATTTTATCAGGTAGCCCAAGCTAATGTGCATGT
GTACCCGAAGGAAATGAGATCGCAACACCAAGCTACTTTA
TGGCTGTTTCTGGAGCATGCGATTTGACGTCATTTCATCA
ATCTATCAATAACTTGCATGTTACACTTACGTGTTACCTC
TGAAGAGTTATCAGTCTATATCGATCGTTGATTGGCTTCT
TAAT

nos1apa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nos1apa-201 (1) 3345
nos1apa-203 2804
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nos1apa-203 Contained in:
OTHER nos1apa-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048757 (1)
  • Ensembl_Trans:ENSDART00000148997 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL917887 (1) 539bp
    GenBank:BC091560 (1) 503bp
    CITATIONS (2)