Transcript

psip1b-204

ID
ZDB-TSCRIPT-110325-2068
Name
psip1b-204
Previous Names
  • ch211-116m6.3-001
  • si:ch211-116m6.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048429 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048429|OTTDARG00000034256|ZDB-GENE-030131-3273 si:ch211-116m6.3|OTTDARP00000037992 CH211-116M6.3-001 LG_ CU905501.8 Danio rerio protein_coding NOVEL, 5566 bp
TTTCACCGGCGCTAAGGGGAGACACTCACTCGTGCACGTC
TACATGTCCGTTCATTCAGAGCGTGAAAATAATTTTAATT
CTTGTGTTTTCTGATTTTTAAACTGCAGTGTTTATTAAAA
TGGTATTTTTGCTCTAAACTGATATGCAGAAAGGAGTAAA
GATGAAATCTGATCAAACCACAGATGATTTTACTCCAGGT
GATGTTGTGTTTGCGAAGATGAAAGGTTATCCTTTCTGGC
CTGCCAGGATTGCAGAAGGAAAAGCCCCCAAAAATAAGAT
CCCCATCTTTTTTTATGGGACACACTCAACAACATTTCTA
TTTCCCAAGGACATCGTCCACTACTGGCCGAACAAGCAGA
AATATGCCCAGGCCAACAAACGGGGCGGCTTCGAGGAGGG
CATGTGGGAGATTGAGAATGACCCGGGTGTGGGACTCAGA
GGTCAAAAGAAAGCAGCGCTAGTGAAACGGCTGTCAGAGA
GTCGACTAAAGTGGAAAAACAAGAAGAAGAAGAAAGCAGA
AAATCAGACTGAAGTGAAGAAACCCCCAAAATCAGCTAAA
GATCCAGTGTCGAAGAGCGATTCAAAAGCAGCGACGCCAC
ATAAGAGAGAAACAAAGTCTGAATCTGTCACACCGAAAGA
TGACAAGAACACCGAAACACGGCCGACACGCTCCAGAGAT
TCATCAGCGAAGACCAGCACAGATAAAAGACGGACAGACA
AAGTTGTGCCTGCCAGAAAAATGACATCGGTGAAGACGAT
CACAACCGGGTGGAGACGTCTGCCATCCAGCGTCATATTA
GCTAGACGGATGGATGCAGCTAAGACTCTTTCTGCTCACA
GGAAACACGTGCTGAATAGGAAGATCATCTCCACGGCCAA
GAAAAGGATTGATGCTGTTAATCACAGAAAGCCCTCAAGA
TACACACGCTCGACTGCAGATCCCATTGAGGCCACTGATG
ATGTCACTGCGAAGCCGCTAGCTCTCAAACGCAAACGGAA
GCAAAACGATTCTGAAGTAAAGGGAGACGCTCCTATTTCT
ATTCCAGCGACAGACATCTCTGTCTCTTCCACTCCGACAG
GCTCGAAGAGAAGACGCCTCACAGAACCTGAGAAGAAGAG
TAAGGATGATGAGAAAGAGCTGAAGGAGAAGGAGGCTCAA
TCAAAAGAGAAAAATGAAGTGGAGCAAAAGATTGAGAAGC
AGAATGAGGTAGAGAAGAGCAATGCTGACAAGAACAAGAT
GATGGAGAAGAAGAATCAGGCTGAAAAGATTGTTGCAGAA
AATGAGACCGAAAACAAAGGGGCAAAAAAGAAAGAGTCAG
AAAAGAGTGATGCAGAAAAGGAGAAGTCTGAAAAGAAAGA
GACAAAAAAGATTGAGACAGAAAGGAAAGAGGCAAGAAAT
AGTGAAGCAGAAAGCAAAGAGCCATGTAAGAACGATTCTG
AAAAGAAAGAGGCAGAAAGGATAGAGACAAGAAAGAGTGA
GTCTGAAGTTTTAGTGACAAAAAATAAAGAGTCTGAAAAA
AGAGAGACAAGAAAGAGCGAGTCTGAAATGAAAGAGGCAA
GAAAGAACGAGTCCGAAAAGCAAGAGGCCAGAAAGAGTGA
GTCTAAAAAAAGGGAGACAAGAAAGAGCGGGTCTGAAATG
AAAGAGGCAAGAAAAAACGAGTCTGAAAAGCAAGAGGCCA
GAAAGAGTGAGTCTGAAAAGAGAGAGACAAGAAAGAGCGA
GTCTGAAATGAAAGAGGCAAGAAAGAACGAGTCCGAAAAG
CAAGAGGCCAGAAAGAGTGAGTCTGAAAAGAGAGAGACAA
GAAAGAGCGAGTCTAAAATGAAAGAGGCAAGAAAGAACGA
ATCCGAAAAGCAAGAGGCCAGAAAGAGTGAGTCTGAAAAG
AGAGAGACAAGAAAGAGCGAGTCTGAAATGAAAGAGGCAG
AAATGAAAGAGGCAAGAAAGACTGAGTCTGAAATGAAAGA
GGCCAGAAAGAGTGAATCTGAAAAGAGGGAGACTAGAAAG
AGCGAGTCTGAAATGAAAGAGGCAAGAAAGAACGAGTCCG
AAATAGAGGCAACAAGAAGCAATTCTGAAAAGAGAGAGAC
AAGAAAGAGTGATTCTGAAACGGAGGCAAAAAATAGCGAG
TCTGAAAAGAGAGAGGCAGGAAAGAGCGAGTCTGAAATGA
AAGAGGCAAGAAAGAACGAGTCAGAAAAGGAAGAGGCCAG
AAAGCGAGAGACTAGAAAGAGCGAGTCTGATATGAAAGAG
GCAAAAAGGAAAGAGACAAGAAAGAATGAGTCTGAAATTA
AAGTGGGAAAAGATAACGACTCTGAAAAGAGAGAGACAAG
ACAGAATGAGTTTGAAATAGAGGCCAAAAATAACGAGTCT
GAAAAAAGAGAGACAAGAAAGAGCGAGTCTGAAATGAACG
AGGCAAGAAAGACAGACTCTGAAATAAAAGAGGCCAGAAA
GAATGAGTCTGAAAAAGAGGCAAGGAGGGACGAGTCTGAA
AAGAGAGAGACAAGACAGAACGAGTCTGAAATGAAAGAAG
CAAAAGATAACGACTCTGAAAAGAAAGAGGCCAGAAAGAA
TGAGTCTGAAAAAAGGGCAATAAGGAATGAGTCTGAGAAG
AGAGAGACAAAGAGTGAGTCTGAAATTAAAGAGTCCGAAA
AGAGAGAGGCAAAAAAGATTGAGTCTGAAATGAAACAGGC
AAGGAAGAACGAGTCAGAAAAGAAAGAGACAAGAAAAAGT
GAGCCTGAAAAGAAAGAGGCAGAAAGGGTCGAGACTAGAA
AGACTGAGTCAGAAAAGAAAGAGGTAAGAAAGAGCGAGTC
CGAAAAAAAAGAGGCAGAAAGGAAATTGGAGAGAAAGAGT
GAGTCCGAAAGGAAAGAGGCAAAGAAGAGTGAGTCAGAAA
ATAAAGAGGCAAGAGGGAACGAGTCTGAAAAGAAAGGGGC
AAGAAGGAGCGAGTCCGAAAAGAAAGAGGCAAGACGGAGC
GAGTCTGAAAAGAGAGAGAACAGAAGGAGCGAGTCTGAAA
AGAAAGAGGCAAGAAGGAACGAGTCTGAAAAGAGAGAGAC
AAGGAGCGAGTCTGAAAAGAGAGAGACAAGAAGGAGCGAG
TCTGAAAAGAGAGAACCAAGATGGAGGGAGTCTGAAAAGA
AAGAGGCAAGAAGGACGGAGTCTGAAAAGAAAGAGGCAAG
AAGGAGCGAGTCTGAAAAGAGAGAACCAAGATGGAGGGAG
TCTGAAAAGAAAGAGGCAAGAAGGACGGAGTCTGAAAAGA
AAGAGGCAAGAAGGAGCGAGTCTGAAAAGAAAGAGGCAAG
AATGAGCGAGATTGAAAAGAAAGAGGCAAGAAGAAGCGAG
TCCGAAAAGAAAGAGGTAAGAAGGAGTGAGTCCGAAAAGA
AAGAGGCAAGAAGGAGCGAGTTTGAAAAGAAAGAGGCAAG
AAGGAGCGAGTCTGAAAAGAAAGAGGCAAGGAGCGAGTCT
GAAAAGAAAGAGGCAAGAAGGAGCGAGTCTGAAAAGAAAG
AGGGAAGAAGGAGCGAGTCTGAAAAGAAAGAGGCAAGAAG
GAGCGAGTCTGAAAAGGCAAGAAGAAATGAATCCGAAAAG
AAAGAGGCACGAAGGAACGAGTCTGAAAAGAAAGAGGCAA
GGAGCGAGTCCGAAAAGAAAGAGGCAAGAAGGAAGGAGTC
TGAAAAGAAAGAGGCAAGAAGGAACGAGTCTGAAAAGAAA
GGGGGAAGAAGGAACGAGTCTGAAAAGAAAGAGGGAAGAA
GGAACGAGTCTGAAAAGAAAGACGCAAGAAATAAGTCTGA
AAAAGAGGCAAGAAGGAGTGACTCTGAACTGAAAGAGGCA
AGTAGAACCGAGTCTGAACTGAAAGAGGCAAGAAGGAAAG
AGTCTGAACTGAAAGAGGCAAGAAGGAACGAGTCTGACAA
GAGTGATGAAGAAAAGGATGCGGTGGAGAAAAACAAGGCA
GAAAAGAACAAGTTGCCGGAGAAGAGGAAAGAGATTAACG
AAGAAGAACGGATAGAGATGATGACTAAACCCAAACAGAC
GAAGAGTTGCGCTCCTGTATCCTCTGATGAGACCCAAGAG
GAGAAGAAACCCAGAGATGAAGAGAGGTGTAAGATCCTGG
CAGAGAAGAGGCAGAGTGTGCTGAAGTCTCTGCAGGGTTT
GGTCACGTCCACCAGAGGGAAGACTCCGAGCGGCTCTGAG
CAAACAACAGAGACTAAGGAGCCACGGAAAGAAAGGAACC
ACAGGCTGAAGAAACCAGCGGAGGACGAGAAGAAGGACAC
GGAGAAGAGGAAAGAACAGGAGAAGAGGAATACTGAGCAG
CAGATTAGTAGCAGTAAAGAAGAAGAGCGCAGAGCTCATT
CTCTCTCCGTCACAGATTCCCTGCTGTATCGTCTCCATGG
TGACATCAGGATATCAATGACGCTAGAAAATCCGGATGTC
AGTAAGTGTTTATCTGCGCTGGATGAGCTGAGCAACGTCC
CCGTCTCATCACGAAACATCCAGAACCACAGCGAGCTCAT
CGACACGCTCAGAAAGATGCGCTGGTTTCGTGGCAGCGAG
GCCATCATGTTTAAAGCCTCCATGCTGTATCACCGCTTTA
AAAACATCTACCTCATCGGGGACGCAGATGAGACCCTGAG
CCAGGAGTACATCAACTCTCTGCAGCAGGAGAGAGAAAGA
GAAATAGAGGAGCGGCACAGAGATGCAGTGCGGACCGAAG
CTGACGTGAGGAAAACACCGGACTTCACTTCTTGTTTTTA
ACTCTTGCTGCGCTATTATTCTGGAATAAGTCATTTTATC
CATCATCTTCGTTTTATCCGGCCACTGAGGGTGTTTTTTA
TTCACACTGGGATGAAGAAGAGTGTTTCCAGCGCAGGGTT
TTCCTCTCAGACTTTTAATGCGATGACGTCAGTGTTTTTC
ATCATCACACAGGCAGTAAAACACACATGATGCACTATAG
AGCAGTTATATTTCTCACGTCTGCGTTTATCCTGTCAGTT
CATTTCGAAGTGAAGGCGGCGTTACTGTTGTGAAGGTTGT
TTTTAGGGTCTGATCGATGCGAGTGGAACTGACAGGATAA
AGACGTTCAGATTTATGCCCTTTCCCTTGTATCACAGAGC
ATTAAATCGCATTAATGGTCAGCATATAAAGCTTGGACAG
ACTTTAAGTGTGTGTTTTACAATCATTATAGATAAAACAC
TATCATTACAGTCCAAAGTATTCATGGCGAGTGTGCCGTT
ACCACTAAACAGTGTCTGAAATACAGCGTTCCCTCTAACA
CACTTTAAAGGGGTGTTTTTATTTTCTCTGTTCTGTTTGT
ATGATCAGGACCATGTTAGGCATTAAAGTTGTATTGTGTG
TGTGTGTGTGTGTGCGTGCGTGTGTGTAAACAAGGCAGCT
AAATCCTCAGTATATAGTGTACAGTGAGACTTTCTGATCT
GAACCGGTGCTAATAACACACACCTGCTGTCTTTAACCCG
ACCACACCTTCAGCCGTAACGCTTTCATTCGCCCCAGGTT
TGTATGATAGAGCACTTGCATGTGCTTCTTGTGTTGATAT
GACGTGAATTTGATCTTGATCATAATAAACTGATCTTCAA
TCCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations