header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2003
Transcript Name: cyp2aa6-001
Previous Names: ch73-73d17.3-001, si:ch73-73d17.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048152 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048152|OTTDARG00000034111|ZDB-GENE-030131-2932 cyp2aa6|no_translation CH73-73D17.3-001 LG_ FP015919.8 Danio rerio unprocessed_pseudogene none, 1804 bp
GTGTTTGTCTGTCATCATGTTAGCAGCTCTCCTGAAGTTA
GACTTGTCCTCCGTGGGCTTAAGTCTGTTTCTAGGCTTAA
TTTTTCTGGTTCTGTTTGAGATCTTCAGAATTCATTCCTG
CAAAGGTCGATTTCCACCTGGTCCAACACCTCTGCCTTTT
GTGGGAAGCATACCTCATTTCTTGAACAACCCAATGGGCT
TCATAAAATCATTATCTCAGTATGGAGAGATGACTACTGT
ATATCCTGGGAGAAAGCCGGCGATAATTCTTAACACTCTT
CAGCTCATGAAGGAAGCTTTAGTCCAGAATGGTTCATCTT
TCTCTGGAAGGCCACCAGTACCTGTTTTCAACTGGGTCAC
TGACGGATATGGAATCGTAATGGCCACATTTGGTCACTCG
TGGAGGCAGCAGAGACGGTTTGCTCTGCACACACTCAGAA
ACTTTGGTCTGGGAAAGAAGTCTGTGGAGGAACGTGTGAC
GGAGGAAAGCGGTTACCTGATTTCTGAATTTCTCAAAGCT
GAAGGCAAACCGTTCAACCCCCAACACGCAATACACAACG
CTGCTGCCAACATTATCTGCTCTATCGTGTTTGGAGATCG
ATTTGACTATGATAACAAGAGCTTCACGTATCTTCTGGAA
ATCATAAAAGAAAACATCATTCAGGCAGGATCACTTGTTG
GACAGGTCTTTAACTTGGTTCCCATCATCAAACATGTCCC
AGGGCCACATCAGAAAATATATCAGAATGGCCAAGCATTT
AAGTCTTTCATCAGGGAATCGGTCAAAGAGCACAGACAAA
CTCTGGATCCTGACAGTCCACGGGATTTTATCGATGCCTA
CCTGCTGGAGATGGAGAAACAAAAGTCCACGCAGGACTCC
ACTTTTCACGAGGATAACATGGTTATGGCAGTAGGTGATT
TGTTCTTGGCTGGAAGCGACACTACAGCAACCACCATTAG
ATGGGGACTCATCTACCTGACTCAAAACCCAGATGTACAA
GAGAGATGTCATGAAGAGATTGTTCGGGTTCTGGGTTTTG
ACCGATTGCCCAGCATGGATGACCGTGACCGACTACCATA
CACACACGCCACTGTTCACGAGTTTCAGCGCTGTGCAAAC
CTTGTGCACAACTGGAGTGCCTCATCAAACAACTCAAGCA
ACAAAACTACGAGGATACGACATTCCCCAGGGAACTCAGA
TATTGATTAACTTGACGGAAATTTTGACTAACAAGGAGCA
CTGGAAGCATCCAGACACTTTTAACCCAGAGAATTTCTTA
GACGATAAGGGACATTTCTTCAAACCGGAGGCTTTTCTTC
CTTTCTCCTTGGGTCCAAGGGCCTGTCTTGGTGAGACTCT
GGCTAAAGCTGAGCTCTTCCTCTTCGTCACTTCTCTCCTT
CAGCGCATTCGTTTCTCCTGGCCAACTGGAGAGAAGTTGC
CGGATATGAATGGGATTTTCGGCATAGTTCGCTCTCCTAA
ACCATTCAACATCATTTGCCATAGCAGAGGTTCAAAACAC
TGACCATCAGTGTCCGTGCTCATATTTACAAGTGTTTCCA
AAGATTTAGACTTGTTTTAAAATTTACTGTATTGATAAAG
AATGTTGTATTACCTTACAACACTATACATTGCTGTAAAT
TAAAGTGCTGAAATAGTATAGCGTGAGACAATGCCAAGGT
TGTGGGATCGATTCCAAAGGAAAACGAGCAATAATTTGTA
CCTTCAGTGCAGTGTAAGTCACTTTGGATAAAAGCATCTG
ATAAATGCATATATTAAAATGTAATACCGATTTAACAGAT
CAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp2aa6-001 Contained in:
[BAC] CH73-73D17 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048152 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)