Transcript

cyp2aa6-001

ID
ZDB-TSCRIPT-110325-2003
Name
cyp2aa6-001
Previous Names
  • ch73-73d17.3-001
  • si:ch73-73d17.3-001
Transcript Type
pseudogenic transcript
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048152 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048152|OTTDARG00000034111|ZDB-GENE-030131-2932 cyp2aa6|no_translation CH73-73D17.3-001 LG_ FP015919.8 Danio rerio unprocessed_pseudogene none, 1804 bp
GTGTTTGTCTGTCATCATGTTAGCAGCTCTCCTGAAGTTA
GACTTGTCCTCCGTGGGCTTAAGTCTGTTTCTAGGCTTAA
TTTTTCTGGTTCTGTTTGAGATCTTCAGAATTCATTCCTG
CAAAGGTCGATTTCCACCTGGTCCAACACCTCTGCCTTTT
GTGGGAAGCATACCTCATTTCTTGAACAACCCAATGGGCT
TCATAAAATCATTATCTCAGTATGGAGAGATGACTACTGT
ATATCCTGGGAGAAAGCCGGCGATAATTCTTAACACTCTT
CAGCTCATGAAGGAAGCTTTAGTCCAGAATGGTTCATCTT
TCTCTGGAAGGCCACCAGTACCTGTTTTCAACTGGGTCAC
TGACGGATATGGAATCGTAATGGCCACATTTGGTCACTCG
TGGAGGCAGCAGAGACGGTTTGCTCTGCACACACTCAGAA
ACTTTGGTCTGGGAAAGAAGTCTGTGGAGGAACGTGTGAC
GGAGGAAAGCGGTTACCTGATTTCTGAATTTCTCAAAGCT
GAAGGCAAACCGTTCAACCCCCAACACGCAATACACAACG
CTGCTGCCAACATTATCTGCTCTATCGTGTTTGGAGATCG
ATTTGACTATGATAACAAGAGCTTCACGTATCTTCTGGAA
ATCATAAAAGAAAACATCATTCAGGCAGGATCACTTGTTG
GACAGGTCTTTAACTTGGTTCCCATCATCAAACATGTCCC
AGGGCCACATCAGAAAATATATCAGAATGGCCAAGCATTT
AAGTCTTTCATCAGGGAATCGGTCAAAGAGCACAGACAAA
CTCTGGATCCTGACAGTCCACGGGATTTTATCGATGCCTA
CCTGCTGGAGATGGAGAAACAAAAGTCCACGCAGGACTCC
ACTTTTCACGAGGATAACATGGTTATGGCAGTAGGTGATT
TGTTCTTGGCTGGAAGCGACACTACAGCAACCACCATTAG
ATGGGGACTCATCTACCTGACTCAAAACCCAGATGTACAA
GAGAGATGTCATGAAGAGATTGTTCGGGTTCTGGGTTTTG
ACCGATTGCCCAGCATGGATGACCGTGACCGACTACCATA
CACACACGCCACTGTTCACGAGTTTCAGCGCTGTGCAAAC
CTTGTGCACAACTGGAGTGCCTCATCAAACAACTCAAGCA
ACAAAACTACGAGGATACGACATTCCCCAGGGAACTCAGA
TATTGATTAACTTGACGGAAATTTTGACTAACAAGGAGCA
CTGGAAGCATCCAGACACTTTTAACCCAGAGAATTTCTTA
GACGATAAGGGACATTTCTTCAAACCGGAGGCTTTTCTTC
CTTTCTCCTTGGGTCCAAGGGCCTGTCTTGGTGAGACTCT
GGCTAAAGCTGAGCTCTTCCTCTTCGTCACTTCTCTCCTT
CAGCGCATTCGTTTCTCCTGGCCAACTGGAGAGAAGTTGC
CGGATATGAATGGGATTTTCGGCATAGTTCGCTCTCCTAA
ACCATTCAACATCATTTGCCATAGCAGAGGTTCAAAACAC
TGACCATCAGTGTCCGTGCTCATATTTACAAGTGTTTCCA
AAGATTTAGACTTGTTTTAAAATTTACTGTATTGATAAAG
AATGTTGTATTACCTTACAACACTATACATTGCTGTAAAT
TAAAGTGCTGAAATAGTATAGCGTGAGACAATGCCAAGGT
TGTGGGATCGATTCCAAAGGAAAACGAGCAATAATTTGTA
CCTTCAGTGCAGTGTAAGTCACTTTGGATAAAAGCATCTG
ATAAATGCATATATTAAAATGTAATACCGATTTAACAGAT
CAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations