ZFIN ID: ZDB-TSCRIPT-110325-1954
Transcript Name: larsa-001
Previous Names: dkey-149g3.1-001, si:dkey-149g3.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047996 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047996|OTTDARG00000034019|ZDB-GENE-110411-16 larsa|OTTDARP00000037661 DKEY-149G3.1-001 LG_ CU468941.10 Danio rerio protein_coding NOVEL, 390 bp
GGCGCCGACGTTTCTTTACGGTGTCATCATCCAGCGTGGG
TTTCACTCTTCAAGAAAAAAAAATCCTGTTGAAATTACTG
GGAATAGATCAGGATGACGGAACGCAAAGGAACAGCAAAA
CTTGACTTCTTGAAGAAGATTGAGGAGGAGGTTCAGCAGA
AATGGGAACAGGACAAGCTTTTTGAGAATGAAGCCCCAGC
CACCATTGGGGAAAATACGAATAAGAACAAGTACTTTATT
ACATTTCCCTACCCATATATGAATGGGAGACTTCACCTCG
GCCATACATTCTGCCTTTCCAAGTGTGAGTTTGCAGTGGG
TTACCAGCGGCTTAAAGGAAAGCAGTGTCTTTTCCCATTT
GGGCTTCACTGCACTGGGATGCCTATCAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
larsa-001 Contained in:
[BAC] DKEY-149G3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000047996 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN863079 (1) 818 nt
GenBank:EB962158 (1) 483 nt
GenBank:EB834359 (1) 453 nt
CITATIONS (1)