Transcript

cyp2aa12-202

ID
ZDB-TSCRIPT-110325-188
Name
cyp2aa12-202
Previous Names
  • ch73-73d17.4-001
  • cyp2aa12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048153 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048153|OTTDARG00000034112|ZDB-GENE-071004-47 cyp2aa12|OTTDARP00000037789 CH73-73D17.4-001 LG_ FP015919.8 Danio rerio protein_coding KNOWN, 1284 bp
AGCGATGTCATGAGGAGATTGTTCGGGTTCTGGGTTACGA
CCGCTTACCATGCATGGATGACCGTGACAGACTGCCGTAC
ACGCTCGCCACTGTTCATGAGCTCCAACGCTGTGGAAATA
TTGTACCATCGTCTGTACCACATGAAACAACTCAACCAAT
GAAACTAAGAGGATATGACATTCCCCAGGGAACTCAGATG
TTGATTAACTTGTCAGATATTCTGGCTAACAAGGAGCACT
GGAAGCATCCAGACACTTTCAACCCTGAGAATTTCTTAGA
CGATAAGGGACATTTCTACAGACCGGAGGCTTTTCTTCCT
TTCTCCTTGGGTCCGAGGGTCTGTCTTGGTGAGACTCTGG
CTAAGACTGAGCTCTTCCTCTTCATCACGTCTCTCCTTCA
GCGGATTCGTTTCTCCTGGCCGACTGGTGAGAAGTGGCCG
AACATGGATGGGATTGTCAGCGTGGTTCGCTCTCCTGAAC
CATTCAAAATCATCTGCCATAGCAGAGGCTCAAAAGAGTG
ACCATGCCTTTCTGACATTTACAGACATTTACAAAAAAAT
CTTGTAGCGTTGAGCCTTTTACAATAGATAACAATGGTGC
TGTAAAACCACTGTAAGACTGTGATATTACAAGATATTCT
GACAAGTACTGTCACCCCCTAGTCAGTACAGGTGCACACT
AGCTGTATATCTTTCATAATCGACTTATATTGACATAGAT
CTGTGACACACACTAGCCCCTTTCACACAGTGATACCGGT
AAATATCCGGAAAATTTCCGGAACGACTTTACCGGTATGT
TCAAAAAAACGCTGTTCACACAGGCGAGGACGTTACGGAA
TTTTTCCGGAAAAGAGCATTCACACATCCATTCCAAAATA
CCGGTAAATTCTGACATCATTCACCACAAATGAGCTTTAA
ACGGCTGCGCTTGTATTTGTAAACATTTGACTAAATTACA
AACTCTGTGGATGATCAATATTGTGAACAACTTTCGCAGG
ATCACTTTCGCATGTCGAGATGTTCATAATATGTGCGTGT
GCAGGCGCTCACAGGCTGTTTCACAGGCACACGCAAAGCT
TGAAGGTAAACAAACAACGGCTTATCATAAGCATCTCATC
GATGATTATTTACACAGTTGGCATTAAGAAGAACATATAA
ACGTGATCTGACTAACTTCTAGCAGCTAAATGTGTCTGGA
AAAATATTCAAAGGCTTTTATTCTCACAAACCGCGCGACG
TAAATGCGTCTGACTGTTGTGATTGGCTAAAGCAGACGTT
TCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations