Transcript

utp15-202

ID
ZDB-TSCRIPT-110325-1852
Name
utp15-202
Previous Names
  • utp15-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039519 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039519|OTTDARG00000028874|ZDB-GENE-030131-3831 utp15|OTTDARP00000031611 utp15-002 LG_ CU467655.8 Danio rerio protein_coding KNOWN, 1892 bp
TGAATATCGATAAAGTTTGTTGAAAACCGGAAGTGTGGCG
TCACAAAATGGCGGCCTCCATGTGGATGTAAAATCAACGT
CCTCAGTGTGAAGCTGCTGTCGGCTGAGATTCAGTGTTTA
TATCTGCGATGGCTTCGTTCAAACCCACCAAAGTCCTGAG
CTATCCTAAACTAGGAGAGAAAGTGACAGAAGAAACACTG
TACTGGAAAAACTACAAGCCTCCTGTACAGATTAAAGAGT
TTGGCGCTGTATCAAAGATCGACTTCTCTCCTCTTCCACC
TCACAATTATGCCGTCACGGCCTCCACCAGAGTCCACATA
TATGGACTTCACTCTCAAGAGCCCATTCGAAACTTCACGC
GGTTCCATGATACGGCATATGGTGGGAGTTTCAGAGGAGA
TGGAAAACTTTTAGTGGCAGGAAGTGAGGAGGGACTGATC
CGACTGTTCGACATCGGGGGTCGAGTGTCTCTCAGACAGT
TCAAAGGACACTCCAAAGCGGTGCATGCCACCTCGTTCCT
GTCTGATGGTTTTCGTGTGCTGTCGGGTTCAGATGACCTG
ACGTGTCGTGTGTGGGACGTCGCCAGTGCCGTTGAGCTCA
GTTCAATCACAGAACACACTGATTATATCAGAGCCATTGC
TCCCAGCAAACTCAACCCAGACGTGTTTGTCACTGGTTCG
TATGACCACACAGTGAAAATGTTCGACGTGCGCTCTGGAA
ACAGTGTGATGACAATGCAGCATGGTCAGCCTGTGGAGTG
TGTGCTGCTGTACCCGTCTGAGGCTCTGCTGGTGTCCACA
GGAGGGCGCTATGTAAAAGTTTGGGACCTGTTGAAAGGTG
GACAGCAGCTTGTTTCTCTTAAAAATCATCATAAAACAGT
AACCTGTGCATGTCTGAGTTCAAGCAACAAACTGCTGACA
GCATCACTGGACCGGCACGTCAAAGTATATAACTCATCCT
ATAAGGTTGTGCATAATTTTGACTGTGCGTCATCTATTCT
CAGTCTGGCTGTTGCGCCTGATGATGAAGCAGTCGCTGTA
GGAATGACCAATGGTGTGTTGAGCATCAGACACAGGAAAC
ACAAAGAAGAGAAAGAAGCTTTAACAGGTCGAAGGAAACG
CGGTCCGTCGTACCGCTTCTTTGTTAAGGGGAAAAACTTT
GTGCCTAGACAGGATGATTTCCTGGTCAGTAAACCAGTGA
GGCAGCATCTACAGAAATACGACAAACAGCTGAAAAGATT
TGAGGTCTCCAAAGCCCTGGACACTGCGCTTGAGACATGG
ACGCGAACTACTAAACCAGAGGTGACGGTCGCAGTAATAA
TGGAGCTGAACCGCAGAGGAACACTGAAAAACGCCCTCGC
TGGGCGAGATGAAGTGAGCTTAACCAAGATACTCAACTTT
CTTCTCAAGCACATCACCGACCCGCGCTTCTCTCGGCCTC
TGCTCACAGTCGGGGATATTGTTCTGGATCTGTATCAGCA
GGTTATTCCCCAGTCACCTGTGGTGGAGCGCCTGCTGCAG
CGTCTTTATGAGATTTTGGGTCGAGAAGCAGAACTTCAAC
AGGAGCTTCTGCAGGTTTTGGGAATCCTGGACACACTTTT
TGCCTCCCTGATGCCCAGAAAAGAGGTTGCAAGTTTTGGC
GCGGCAGCAGCAGCGCAGGAGTCCCAGCTACAGGCTGCCT
GAGGCCGTGTGTGGTCTCATGACACAAACCGAAACATGCT
GGACTTGACTGAGACGTGGTGAAACTGGAAAGAGAAAATG
GAAGGAAATAAGTGCGAGAAGGAGCTGCGGGTAACAAGTT
GCCCAATGCCAGCGTGTCATTCACTTTCTGCTGATGTTCG
CAGAATTTAAGACTGTATTTTGTATATTCCTGTCATAAAC
CTTTTGAATTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations