ZFIN ID: ZDB-TSCRIPT-110325-1829
Transcript Name: ensab-201
Previous Names: ensab-001, dkey-30o16.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023160 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023160|OTTDARG00000018949|ZDB-GENE-060526-294 ensab|OTTDARP00000019278 DKEY-30O16.6-001 LG_ BX248517.11 Danio rerio protein_coding NOVEL, 655 bp
ATTCCCATTGGCTTTCCCGGAGTGTGACCGTCCTCCAAAA
TGACGTCACTGCAGCGAACGCCATTTTGATACTGAACACC
GTGGGTGGATCAGATCGGGCACGAATAGACTGTAAAATTT
ACACACTAACACGTTGATTAACTGGTCAGCAGACGCCGAA
CAGCCATGTCATCAGACAACCAGGACACGGAGACGCATCC
GGAGCAGGTGGACGAGACTCAGGAATCCCAGGACACAAAC
TCAAACCCAGTGCGGACAGAAGAGGCCAAATTGAAAGCGA
AGTATCCCAACTTGGGTCAAAAGCCAGGTGGATCTGATTT
CCTGATGAAGCGCCTGCAGAAAGGGCAAAAGTATTTTGAC
TCAGGAGATTACAATATGGCCAAGGCAAAGATGAAGAACA
AACAGTTGCCTGCTGCGGCCGGTCCAGACAAGAATATCGT
CACCGGTGATCACATTCCTACCCCACAGGACCTTCCCCAG
AGAAAGTCCTCACTGGTTACAAGTAAACTAGCAGGCTAAC
GTAACTCACAGGTTTTGAAGAAACCCTCTTACCAAACTTC
CAAAACCTTCCCAGACCCTCCAGACCAGCTTCACCAGGAC
TGGTTACCGTTATTTTTGAGTTCTTTTTTTCATTTGCGTG
TATAGTTTCGCTATC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ensab-201 Contained in:
[BAC] DKEY-30O16 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000023160 (1),  Ensembl_Trans:ENSDART00000088146 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR927023 (1) 539 nt
GenBank:CB359638 (1) 525 nt
GenBank:CK677953 (1) 320 nt
CITATIONS (2)