Transcript

si:ch211-186e20.7-201

ID
ZDB-TSCRIPT-110325-1820
Name
si:ch211-186e20.7-201
Previous Names
  • ch211-186e20.7-001
  • si:ch211-186e20.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019883 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019883|OTTDARG00000016538|ZDB-GENE-110407-6 si:ch211-186e20.7|OTTDARP00000016807 CH211-186E20.7-001 LG_ CR559930.6 Danio rerio protein_coding NOVEL, 1464 bp
ATAACTCAGTCTAGTTTGAGAAGAGGAACAACAGTTGTCT
TTAGAGAGCCTTCAAATAAAACCATGGAACGGAACGGTGT
ACTTTTGTGGATTTTTGGTTTTGCAATAGTTGTCTGTGGG
AATCAAGAGACTTTACAACAACCTCCCATTAGCGCTAAAC
TCCCGTCATTGATAAACATGAACAACGATTTTGCTTTTCA
CCTGTACAAAAGGGTTATTGAATTGCCTGACTATCAGTCC
AAAAACATCTTCTTCTCTCCGTTCAGTGTGTCTATGGCCC
TTTCTGAGCTTTCTTTAGGAGCCGGTGGAGACACCAAACA
GCAGCTTCTCAGTGGCATTGGCTACAACAGCACAATCTTC
AGCACTGAGGAAATGCACCAGCTGTTTCACAGTCTCCTGG
AAGACATCAGCAATAGGACAGGAGTGGATATCGATGTCGG
CACTGCTCTTTATGCAAGCGACCGATTTAAGCCTCATTCC
AAGTTTCTGGAGGACATGAAGGAGTTTTACCACTCTGATG
GCTTCACTGTAGATTTCAGGGTCAAAGAAACAGTCGATCA
AATTAATAATTATGCAAAGAAAAAAACACAAGGAAAAATC
AATCAAGCTGTTGATAATCTGGAAGACGATACTTTGATGT
TTCTTCTCACATATATATATTTTAAAGGAAAATGGGACAA
GCCTTTTAAGCCAGAAAAAACCCGTGAGAGTACATTTCAT
ATAGATGATAAGACCACAGTTACGGTGCAAATGATGCATC
AGTATGAACGTCTCAAAGTCTTTTATGATGCTGAACTGTC
CACTAAAGTCCTCTGTCTTGACTACAAGGATTCCTTCTCC
ATGTTTCTGGCTGTCCCAGATGATAAAATGGAGCAAAAAA
ACATCAAAGATCTAGAGATGACAGTCTCTAGACAGCACGT
TGAAAAGTGGAAGAGAAGTGCCTTTAAAAAAACAGTTGAC
ATCTACGTCCCCAAGCTTTCTCTGAAAACATCATACTCCT
TGAAGGATATTTTGAAGGGAATGGGAATGGCTGATATATT
TTCAGATAAAGCCAACTTTACAGGAGTTTCAGAGGAAAAG
ATCTTCGTTTCAAAGGTTTTGCATAAAGCCACTCTGGATA
TCGATGAGCAAGGAACCACCGCAGCAGCAGTGACAGGAGT
TTCAATGAGAGTAAGGTTACACAACCCATTGAGTATTTTA
AAATTTAATCGCCCATTCATGATCTTTATCACGGATCAAA
CAAATGACAACATCCTTTTCTTTGGGAAAGTCGTCAACCC
AAATGAAAAACTGTGATGTTGCCCACAAGATGTTAAGACA
ATGTTAGCCAGTAGGTGGAAACCATTTAACAACTGCAGTG
CCATAGATTGCAGATTTTGTAGAGTTCAGTTTTTATTGTT
TTAACACATCTGAAGCAGCTTATTTACTGTAGGTGATGGT
TGGAAAAAAATAAACTGCAAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations