Community Action Needed: Please respond to the NIH RFI
Transcript

sergef-002

ID
ZDB-TSCRIPT-110325-1800
Name
sergef-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051121 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051121|OTTDARG00000035872|ZDB-GENE-061220-11 sergef|no_translation sergef-002 LG_ CU394253.9 Danio rerio protein_coding KNOWN, 742 bp
GTCTTTACGTGGGGCAGATCCAATTACGGACAGCTAGGCC
AGACTGATCACAGCATGGAAAAACAGTCAAGTGATGAGCA
CCTTGTGAGATCCCCTGTTGAGGTTAAAGCTTTATTTGGA
GCCACACAGATTTCATGTGGATCTGAACACAACCTGGCTG
TTGTGGGGGGTCGGGTCTTCTCCTGGGGCTGGAATGAACA
TGGAATGTGTGGCGACGGTTCCCTTCAGGACATCACACAA
CCTCAGCCAATCCCTGCTCTCGCCGATGCTGTGGCTCTTC
TGATTGGCTGTGGAGCAGGGCATTCAATGGCACTGTGCAG
TTTGAAGAGCAGTGAAGACTCAGCAAGATGAGCAGAAAAA
GACACAAATAGCCTTAACAACATGTCAACTCAAACCATCA
ATGAAAACACCACCTGCTTTTAAATAACTATCCATACTAC
GCACTGCAATGTGCTGAAAAACACAAGGAACGTCTCACAA
AACAGCACAAACGTGAGCCTTTTACAGTCAGGAAGTTGAA
TATCCAAAAACGCATTTGTAAAAGACTGTAAACCTCTTAA
ATGTATTGGTTTCTATAGTTTGTTCTCTGATGTGGTCGGG
TCTTTGAACAGTCCAGCATATTATAAGGAAACGACCCAAC
TTTGACATTCCTGTGATACAACTGGCAGTGCGCTAGTTTG
GCCCCAAAAAATTGGGTTTACTTCACATTTTCACAACAAT
GATAAACAAACGTCGAAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations