ZFIN ID: ZDB-TSCRIPT-110325-1800
Transcript Name: sergef-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051121 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051121|OTTDARG00000035872|ZDB-GENE-061220-11 sergef|no_translation sergef-002 LG_ CU394253.9 Danio rerio protein_coding KNOWN, 742 bp
GTCTTTACGTGGGGCAGATCCAATTACGGACAGCTAGGCC
AGACTGATCACAGCATGGAAAAACAGTCAAGTGATGAGCA
CCTTGTGAGATCCCCTGTTGAGGTTAAAGCTTTATTTGGA
GCCACACAGATTTCATGTGGATCTGAACACAACCTGGCTG
TTGTGGGGGGTCGGGTCTTCTCCTGGGGCTGGAATGAACA
TGGAATGTGTGGCGACGGTTCCCTTCAGGACATCACACAA
CCTCAGCCAATCCCTGCTCTCGCCGATGCTGTGGCTCTTC
TGATTGGCTGTGGAGCAGGGCATTCAATGGCACTGTGCAG
TTTGAAGAGCAGTGAAGACTCAGCAAGATGAGCAGAAAAA
GACACAAATAGCCTTAACAACATGTCAACTCAAACCATCA
ATGAAAACACCACCTGCTTTTAAATAACTATCCATACTAC
GCACTGCAATGTGCTGAAAAACACAAGGAACGTCTCACAA
AACAGCACAAACGTGAGCCTTTTACAGTCAGGAAGTTGAA
TATCCAAAAACGCATTTGTAAAAGACTGTAAACCTCTTAA
ATGTATTGGTTTCTATAGTTTGTTCTCTGATGTGGTCGGG
TCTTTGAACAGTCCAGCATATTATAAGGAAACGACCCAAC
TTTGACATTCCTGTGATACAACTGGCAGTGCGCTAGTTTG
GCCCCAAAAAATTGGGTTTACTTCACATTTTCACAACAAT
GATAAACAAACGTCGAAACAAA

sergef TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sergef-201 (1)    Ensembl 1886
ncRNA sergef-002 742
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sergef-002 Contained in:
[BAC] CH73-334L12 (1)

Genome Resources: Vega_Trans:OTTDART00000051121 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)