Transcript

ncalda-202

ID
ZDB-TSCRIPT-110325-1775
Name
ncalda-202
Previous Names
  • ncalda-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051014 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051014|OTTDARG00000035805|ZDB-GENE-080220-28 ncalda|OTTDARP00000040094 ncalda-003 LG_ CU104697.13 Danio rerio protein_coding KNOWN, 879 bp
GAAGAATCTTGAGTACTTGTTGAATTGACACGGTTATTCT
TGTTCTCTGTGATCTCTGTACTTGGTCTTTTAAAACTCCC
ATCATCGTCAGCTATAAACTGCTGGGTTATGGACTGTTGA
AGGCAGTGGATTGCAGGGGAAAATAGAAAAAAAAGAGTAA
AAGAGAGTGCTGTCTTGTGAAACGAAACCATGGGGAAACA
GAACAGCAAGCTCCGGCCTGAGGTGATGCAAGACCTGTTA
GAGAGCACAGACTTTACAGAGCACGAGATCCAGGAATGGT
ACAAAGGCTTTCTAAGGGACTGTCCCAGTGGCAACCTCTC
AATGGAGGAGTTTAAGAAAATCTATGGAAACTTCTTTCCT
TATGGAGATGCCTCAAAGTTTGCAGAGCACGTTTTCCGTA
CGTTTGATGCAAACGGCGATGGTACCATTGACTTTCGGGA
GTTCATAATTGCATTGAGCGTCACGTCACGAGGAAAACTG
GAACAGAAGCTTAAGTGGGCTTTTAGTATGTATGATCTGG
ATGGAAACGGCTACATCAGCAAATCAGAGATGCTTGAGAT
TGTGCAGGCTATTTACAAGATGGTGTCATCAGTGATGAAG
ATGCCAGAGGATGAGTCCACACCTGAGAAGAGAACAGAAA
AGATCTTCCGACAAATGGACACCAATCGGGATGGAAAACT
GTCTCTGGAGGAGTTTATCAAAGGCGCAAAGAGTGACCCA
TCCATTGTTCGTCTGCTACAGTGTGATCCCAGCAGTGCAG
GACAGTTCTGAGATCAGCGTCTCGTTCTTCAACCTTTTAT
TTATTTATTGGTTTTAATTTTGTTTTTGAGAGTCACTCCT
TCTGCTTGCAGGGAAATGATGCAGGGTCCTTTTTTTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations