Transcript

ap4e1-201

ID
ZDB-TSCRIPT-110325-1750
Name
ap4e1-201
Previous Names
  • ap4e1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050902 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050902|OTTDARG00000035740|ZDB-GENE-061221-3 ap4e1|OTTDARP00000039976 ap4e1-001 LG_ AL954697.15 Danio rerio protein_coding KNOWN, 3728 bp
GGTAGGCGGTGAGAAAGTCCAGTCATGATGGTCGTGTTTT
CATACAGTGTTTTGACAGTGTTGTAGGTTTAGTGTGTTTT
TGTCCTGCTCTACTGCACTTATCTTCATGTATACTCTCGG
CTGTGTGTTTTGAGCTGCTCGTGTGTGTGTTCTGCTGCTG
AAATGAGTGATGTTGTGGAGAAAACTCTCACTGCTCTGCC
GAGTTTGTTTGATTCTCAAACCGGAGCCGCAAAAATCAGC
AACAGACTCAAACAGCTGATCAAGAGCATCACAGAGCTGA
CCTCCAAACATGACGAGGAGAGTCTCATCAAACAGGAGCT
CTCGGCCATGAAGGAGCAGGTTTCGGCTCCCAGCACCAGC
ATGAAGCAGATGAGAGAGATCATGGTGAGGTCCATGTACT
GTGAGATGCTGGGCTACGACGCCTCCTTCAGCTACATCCA
TGCCATCAAACTGGCCCAGCAGGGCGGCGTCATGGAGAAG
AGAGTCGGGTATCTGGCAGTGTCTCTTTTCCTCAGTGAAG
GCCATGAGCTGCTGCTGCTGCTAGTCAACACAGTATTAAA
GGATCTTCAGAGCACCAACCTGATTGAAGCCTGCATGGCC
TTGACTGTTGTAGCTCAGGTGTTTCCCAAAGACATGATTC
CTGCTGTCCTTCCTCTGGTGGAGGACAAGCTTTCACACCC
CAAGGAGATCATTAGGAGGAAAGCTGTCCTGGCCTTATAT
AAGTTTTATCTCATCGCTCCTAATCAAGTGCAGCACATTC
ATGCCAAGTTCCGGAAGGCTCTGTGCGACAAAGATCCTGG
AGTGATGACGTCATCCTTACATATTTACCTACAACTCATA
CAGGAGAGTCCGGACGCCTATAAGGACCTGACGGGCAGTT
TTGTCACCATCCTGAAGCAGGTTGTTGGTGGGAAACTCCC
GCTGGATTTTAACTATCACAGCGTTCCTGCGCCTTGGCTT
CAGATCCAGCTGCTCCGCATCCTCTCGCTGCTCGGCCGGG
ATGACCAAAGCACCAGTGAGCTGATGTATGAAGTTCTGGA
CGAGTCTCTGCGCAGAGCGGAAATGAACCACAACATCACC
TACGCAATCCTGTTTGAGTGTGTGAAGGCCGTCTACACCA
TCCACCCTAAAGCAGAGCTTCTGGAGAAAGCAGCGAGATG
CATCGGGAATTTTGTTCTGTCTCCAAAGATTAACCTTAAG
TATCTCGGTTTGAAAGCCTTGACGTATGTTGTCCAGCATG
ATGCCAAACTGGCCTTACAGCATCAGATGACCATTATTGA
GTGTTTGGACCACTCAGATTTCACTATTAAAAGAGAGACT
CTTGAATTGCTGTTCAGGATCACGAACGCTCAGAATGTGA
GTGTGATTGTTGAGAAGATGCTGGATTTTCTGCGCAGCTG
CAGCGACGAACACACCATCATCCATCTAGCCGGAAAAGTG
GCAGAGCTCGCTGAAAAGTTTGCTCCAGACAACTCCTGGT
TTATTCAGACCATGAATGATGTTTTTTCTATCGGCGGAGA
TTTGCTGCAGCAGGACATCTCCAATAATTTTCTGCGACTG
CTGGCGGAGGGATCAGAGTCTAAAGAGGAGGATGATCAGC
TACGGCTGTACGCTGTCGACTCGTATCTGACATTATTGAA
CGGAGACGCTTCTCATCTGCCGCAACGCTTCATTCAGGTC
ATGAGCTGGGTTGTTGGTGAGTATTCTCATCTTCAGGAGT
GTGTGGATCAGAGCGAGGTGATTCGGCTCCTGATGAAGCT
GCTGGAGCAGAAGAGTGTGAGCTCAGAGACGCGGGTCTGG
ATTCTCTCAGCTCTGACCAAGATTTCAGATGGCCAGACAG
ACTTAATTCTGGAGCTGGCAGAGAGTATTTCATCCTCTCA
GGACACGATTCTCCGTCAGCAGGCCCACGAGCTGCGGCAT
CTCAGCCTGGACTCAAAGCTACATGAGTGGGTTTTGCCCC
GCGGAGCCGCCTGGGACGACATGGAGGTCGACTCTTCTTT
GTCATTTCTGGATGGGTTTGTTTCTGAAGCTTTGGCTGCA
GGAGCCGCACCATATAAACCTCCTCATCAGAGACAAGAAG
AGCTGTGTGAGCAGAGAGCACTGAATCTGGAGCCATACAG
TTTTTCTCTGCCTGTGAGTTTGTCATCGTGTAGCATCACT
GACAGACACTCTCCTACATTACTGTCCGTCAGCTCAGGAC
TTTCAGGCAACAGCACTGAGCTCTCTCAGAAAGCAGGTGC
CAGCACTCTAATCCTCGAGGGTGTAAAGAGAGTTTGGGGT
AAAGATGGGTACCTTCCACAAAAAGAAACAGCAGTAACAG
CCTCTCCGGTGGATGAGCCCAGTGCTGCAGTTCAGCCCGT
CGGCCAGCAGGAAGCAGCAGAGAGATTAGAGCCACAGCCG
GAGCCTTCAACGCAAACCAACGACAAACAGCAGCTGGCTT
CCTCTTTGTTTGTTGGTTTGAGTACGCAGAGTTCCACATC
TTTGCTGGGAAAATCTGAAGCTCCGCCTCCTCGGTTCAGA
AAGAAGCCCCGCCCTCATGGATCATCATTATCATCCTCAT
CCTCATCAGGAACAAGTGAAAAGTCTTCCTCCTCCCGGAC
CTCACATAACACAACTGACAGCTTCCTGTATGGCAGTTTG
CTAGAGGAGGAGCCAGCCGGTTTTGACCACACCCCCAAAT
CCATCACAGCCAATGGTCTTGGCCAAAATAAAGACGTTAA
AGAAGACAGACGTACAAACACATCTCAGATACTGGGCAGT
GATATGGTGATAGTGCGGCCCAACACAATACAACACAATC
CGTCCACGTCTTCAGACCTGACCACTCTCTTACCTGCAGA
CCTTAAAGACCTACCTCACTCTGATGTCATCAGCCTGACC
TCTGACCCCAGCCTGAGTGTGTCATCCTGCCGCGTGTTCA
GAGATGAAGCTCTGCTGCTCGTCATCTTCATTTCTAACAG
CACAGAGACTGATATAAGAGATGTTGCAGTGCAGCTCAAC
TGTGACCAGCTGGAGACGGTGAGTTTGCGAGGGAATATCG
TGGACTGTCTGGAGGGCAGGAGTGTGTCTGTATGCCATTA
CGCTCTGCTGATGGACGACCCTCACACTAATGTGTCCTTT
ACCGGGAGCGTCTCTTATCAGATACAACCAGGACACACAA
ACACACTCTCTTTCTCTGGGACACTGTCCACAGCGGACTT
TATCAGGCCTTTAGTTGTAACCACAGATGAATATGGGAAA
CTCTGGCTGTCTCTGTCTCATGACGTCAAGCAAAATCTGA
AACTGCTCACAGATGCCGGTGACCCTCTCCAAACAACCCT
GAATGCCCTCAAGGACACCCTACAGCTGCATATAGTGGAC
ATCATCGGCTCAGAGGGAATCGTAGCATGTCGTCTGCTCA
GCGGCGCCCCCTGCCTCCTGCACTGTCGAGTGAACGGCTC
TGCTCTGGCCATGTGGCTGCGCTCTCCACTTCCTGCTCTC
CCAGACTGCATCCTGTACCACTGTCAGAGAGCGCTCGCAC
AACACTAAACATCCACAGACCCGCTCATATCTTCCTGGGA
AGCTCCGCAACAGTGTTTACAGGTGTCTGTGACTGATAAT
GCAACGACTATTTGAAAGCAATACTTGGCTATTGCGCGTC
TGACTAATAATTTTATTGATATATATTTTTTGTACATTGA
ATTTCATTGTGTCAACAACGCTTACATAGAGTAAAAGTTA
TTTATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations