Transcript

rps25-202

ID
ZDB-TSCRIPT-110325-1662
Name
rps25-202
Previous Names
  • rps25-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050492 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050492|OTTDARG00000035478|ZDB-GENE-040426-1788 rps25|OTTDARP00000039639 rps25-001 LG_ CU633908.12 Danio rerio protein_coding KNOWN, 549 bp
ACTGAACTCTGAGACCGCGCACGCTCCGACAGTCGAAGCG
CGCACGTGGACGGACAAAGCGGACGTGCGCGTTCACGACT
TCCTTTCTCTTCCGCAGCTCGCAACGCCTCAGCATGCCGC
CCAAGGATAGCAAGCAGAAGAAAGATGCGGGCAAGTCCAA
AAAGGACAAGGATCCCGTCAACAAATCCGGAGGCAAAGCG
AAGAAGAAGAAGTGGTCCAAAGGAAAGGTGAGGGACAAGC
TGAACAACCTGGTCCTCTTCGACAAAGCCACTTATGACAA
ACTGTACAAAGAAGTGCCGAACTACAAGCTGATCACCCCG
GCTGTGGTTTCTGAGAGGCTGAAGATCAGAGGCTCCCTGG
CCAGAGCTGCCCTGCAGGAGCTGCTGGGAAAAGGCCTGAT
CAAGCTGGTGTCCAAACACAGAGCTCAGGTGATCTACACC
AGAAACACCAAGGGCACAGACGAGGCAGCTCCAGAAAAGG
AGGCATAAACATGGTTCCTTGGCTTGAGTTATGGTCTTTT
GTATAGATGAATAAAAACCATAAAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations