ZFIN ID: ZDB-TSCRIPT-110325-1642
Transcript Name: ets2-203
Previous Name: ets2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050406 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050406|OTTDARG00000035421|ZDB-GENE-050522-552 ets2|OTTDARP00000039569 ets2-001 LG_ FP325119.3 Danio rerio protein_coding KNOWN, 2301 bp
CTGGAGATTCAGTCGCGCGCACAGACGAGACTCAAGATAA
ACGCGTGAACTAACCAACACACACACACAGATAAACAAAC
ACACACACCGCGAACGATTTAGGAATATAAACCAATCGAT
CGACCGGAGGAGGGAAACACTGCAGCGCAAGCACCGCGGA
TTATTGAGTTATTCCTGTCAGAATTCAACAGGTCTCAGTG
TGTAAAATGGAGTCGCTTTTACCTGGATTCAGAAACACAC
TCAAGCGTCAGGCAGCGTTTGAGCTGTTTGAGGACCCCAT
GTCCCTGTTCTCCGGCTTCTGTCCCCTGGAGGAGGAGCAG
GCGGCTCAGGAGGTCCCGTCCGGCCTGGACTGCTTCCCTC
AGGATGCTGGTGTGTGTTCGGTTCCTCTGCTGACGCCCTG
CAGTAAAGCTGTGGTCAGTCAGGCTCTGAAGGACAGCTTC
AGCGGGTTCTCCAAAGTCCAGCGCATCTGCGGCATCTCTG
ACAACCCGCGCAGGTGGACGAAGCAGCAGGTCCTGCAGTG
GCTGTACTGGGCGTCCGGAGAGTTCAGCCTCACCAACATC
AGCTTCTTCAGCTTCGACATGAGCGGACGGGAGCTCTGTG
AGCTGGGCAAGGACAGGTTCCTGGATCTGGCTCCGGATTT
CGTGGGGGATATTCTGTGGGAGCATCTGGAGCAGATGATG
AGAGGCTGTGTGGAGGACGAGGAGCTGAAGGTGTCTGACT
GCAGCTGGCCCAGCAGTCTCAGTCTGGACGAGTGCTCTCT
GACGGCTCCGAATCCTCACAGTAGTCTCCTGCGAGAGCTC
TTCCAGACGTCTGATGATGCGGCTCTGCTAGCGTCCGCCG
CGGAGCTCCCGGCGTGTGCTAAGCCTCAGCTCAGCACGGT
CAGCGTCCGCTACAGGAGCCACGAGTTCACCAAAAACACT
CCGCAGCTCCGCACTGCAGGCTCATCCGGGGAGCAGGCGT
CACAGGAGAGTGTGGAGAGCGCAGAGGAGTGTGTGTTGCG
CTCCTGGGGAAGCCACTCGTCGCTCGCGGACACCCAACGC
GTGCCGTCCTACGACAGCTTCGAGGAGGAGCTGCTGCCGC
TGGGCCTCCAGAAACACGGACGCTCCTTCAAAGACTACGT
GCAGGAGAGAAACCAGACGCAGGAGACCGGCAGACCCGTC
ATACCTGCAGCCGTGCTCGCCGGATTCACTGGAAGTGGCC
CTATCCAGCTGTGGCAGTTCTTGCTGGAGCTGCTGACCGA
CTCCACCTGTCAGAGCATCATCAGCTGGACCGGAGACGGC
TGGGAGTTCAAGCTTACTGACCCTGATGAGGTGGCGCGGC
GCTGGGGAAAGAGGAAGAACAAGCCCAAGATGAACTATGA
GAAGCTGAGCCGCGGCCTGCGCTACTATTACGACAAGAAC
ATCATCCACAAGACCTCGGGGAAGCGCTACGTCTACCGCT
TCGTCTGCGACCTGCAGAACCTGCTGGGCTACACCGTGGA
GGAGCTGCACGGCCTGCTGGGAGTTCAGCCGGACAGCGAG
GACTGAGCGTGCGCGCGCGCGTGTGTGTGTGTGTTTCTGC
AGGCCGCTGCGGGTCTGTGTTTATGGCTGATGCCGGAGCA
AACGTTTCTCCTGTGATGAGAACGGCCACACTTTGAGCCG
CTCACACACTCTCTGCACTGATCTGAGGACAGTGTGTGTG
TGTGTGTGTGTGAGCGCTGCACACTGGTTTATTGAGCGCT
GGATCTTCAGCAGTGTTTCTCACATGTGTCTGACGCTCAG
CTCTCTCTCTCTCTCTCTCTGTGTGTGTGTTTCTGATGAT
CTTGTGTATTGATTTCCTCTCGCTGCTCTGTGGAGGACGC
TTTCGCTCAGGCCAAAGGGACGTGGAGATCCCGACTGAAT
GTTTACTTGACCAAAGCTTCAGTGATGATGATGAAGATGA
TGATTGTCTCTCCATCAGGAGCAGAACTCTGTGTTTCCCT
CCAGACTCCTGGAGCTTTATTCTGATCATGTACGCGGTCA
GCTCTGCGCACGCGTGTGTGTGTGTGTGTATTTATATGTC
TGTACGGGCTGTTTTGTATGGAGAGCTGCTCTCGGAGCAG
GTTTATTTTCCCGATGGTGGAGATGGATTTTCCCAGAGCG
CTCGTTCAGCTTTTATTACTGAAGCTCCCTGGGTGGGCTT
TGTGCTGGACGTCCTCTGTGGACTGCTTTACTGGACTCTT
GATGATGACAATCTGCCCAGACACACAGCTTAATGTCTGT
AACACACTGCCAACACTTTCATATCGCCCACACGGTCAAA
CAATAAAGGATGCTGAACTGA

ets2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ets2-202 (1)    Ensembl 652
ets2-203 2301
ncRNA ets2-003 (1)    Ensembl 872
ets2-004 (1)    Ensembl 742
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ets2-203 Contained in:
[Fosmid] CH1073-43N20 (1)

Genome Resources: Vega_Trans:OTTDART00000050406 (1),  Ensembl_Trans:ENSDART00000161007 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC095899 (1) 2147 bp
GenBank:AW165159 (1) 498 bp
GenBank:FP160048 (1) 398 bp
CITATIONS (2)