Transcript

gon4l-201

ID
ZDB-TSCRIPT-110325-159
Name
gon4l-201
Previous Names
  • gon4l-001
  • dkey-202i12.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048058 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048058|OTTDARG00000034058|ZDB-GENE-070117-2447 gon4l|OTTDARP00000037716 DKEY-202I12.3-001 LG_ CR848841.19 Danio rerio protein_coding NOVEL, 6756 bp
ACACCCGCCGTTTGTTGTGAAGCGGCGGGCTTAATAGAAA
GATACCGATGGCTGCAGACATACGTTCCTGGGCTCAGAGA
CAGATTGAACATGGGATGGAAACGCAAGTCTTCTTCTCCA
GAACCACAACCAAATCTTGTCAAACTACCAAAGAGGGAAT
CCCTCAGCAGATCTCCTAGCTCATGGAAGAGGAAGGCCTC
TACACCCAGTAAAACAAAGAGCTGGACCTCCATTCAGTCC
CTTTCTCCAGACAGGCATGTTGATCAGTGCAATGGCCAGG
AGAAGATGTCCAGCGCAGGTCATGTTGAAGATGACAGTGA
CTGTATCCAGTCCTCTACTCCAGTTTCATCCCCTTTGCGG
TCAGAAGAGGATGCGGAGCTGGGTCTGGTCATCACTGTGG
ATGAGGACAGATGTGAAGGGGAGGAATGGCTGAAGAAACG
GAATGGAGTGAATATAAAGAAGAATGGAATAAATCAGACA
GAAGGAGAGATCCCTCAGAAAGAGGATGGAGATGTGGAGA
AGACTATGGAACAGCTAAGTGAAGAAGATGAGAATGAGGA
AGAGCTCAGGAAGCTGGACAGAGATTTAACACTCAAATCT
AAAAAACTCAACCTCTCCTCTATCAATGTTCGTAACATCA
TCCATGAGGTGGTAACCAATGAGCATGTTGTGGCCATGAT
GAAAGCTGCCATAAAAGAGACACAAGACATGCCCATGTTT
GAGCCTAAAATGACTCGTTCTAAGCTGAAGGAAGCTGTTG
AAAAAGGGGTGGGCATGGGAAACTGGAACATCTCACCAAT
AAAGAAGGCAAATGACATTAAGCCACCTCAATTTGTGGAC
ATTCCACTGCAAGAAGAGGAGGACTCCTCAGATGAAGAGT
ATTGTCCTGATGAAGACGAGGAAGATGAAACAGCTGAGGA
GACGTTTTTGGAGAGTGATGTGGAAAGCACATCCTCCTCA
CCCCGCGGCATCAGACGTTTTCCTTCTCAAACGCCTCCCC
ATTGTGATGATGCCAGCAACAGCCCCAGACTGAAGCCCAG
GCTGGCCCGGCACTTGAGGGTCGAGGCAGTGCCTATGGGT
CCCCCTGCCCCTCCTCCTCAATCCTGTGGCCTTTCACGCT
CTCTTAAGACCCTGGACCCCTTCATCGAGAAACTCCATGC
TGTGGATAAAGAACTTGAACTAAGTCCTCTCTGCATGGAG
CCTTATCAGGCTCTCAGTAGTGGTGGAGCAGGGGAGCCAG
ACGACAGTCTAGTAGCTTGTCGAACTCGGTCTAAGCGTCC
ATTGCGGGACGTCCCTCTTGATCAGCTGGAGGCCGAGCTC
CGTGCGCCAGACATCACGCCAGATATGTATGATAATGTCT
CCACACCAGAGGACCGTGAATGGACCCAGTGGCTGCAAGG
ACTCATGACATCTCATCTGGACAACGACGAAGAAGCTGAT
GAAGATGACGACCCCGAATATAACTTCTTAGATGATTTAG
ATGAGCCAGATTTGGAGGATTATCGAAATGATCGTGCTGT
TCGTATTACAAAGAAGGAAGTCAATGAGCTCATGGAAGAG
CTGTTTGAGACGTTTCATGATGAGTTGGCAGCCAATGAAC
CAGATGACGAAGGTCATGATGAAGATGAGGAGCGTGAAGA
GGAGGCTAATGACACTCCACAATTCAATGTCCCTCAAGCT
ATTAGGTTTGAGGAGCCGCTGGCTCACATGTTGACAGCAT
GCAGGCGGACAGTTAGAGAGCAGCTGGATGCTTTACAGCA
GCGGCGAGAAAACCAGGTCCGGACTACCCAGCATGCATCT
GGGCCTGGCATGGTTTTTGTGCAGCCCAGCTGCCCTCTAG
TTGTCACACCTGCACAGAGGATACAGCTGCAACAGCAAAT
ACAGCAACATGTCCAATTACTGACCCAGGTCAGTATGCTG
TGTGACCCAGTGGGGGCACTACAAACTGAAGCTCAAACCA
CCAAACATTTCTTGGGGGAGTTGCTGTCATTTGCAGAGCG
GGCTGAGGAGGAAAGATCAGCAGTGAATCTGGGTTTTAAA
AGTGTATTTAGGGTGTGTAATTTGCTTTCGTCCATCAACT
TGTTGGAGGAGGTTAAGCAAAGTCCTTCTCTTTCGTGTCT
TCCTCCCAAACCCAACCGGCATCACTCAGTTCATTCGTAC
CCTTTGCTTCCTGCTGGACTTGCATGGTTGTTCGCCACCC
GCTCTGTCTTTCTGTACCCAGAACTTCTTCCACATTGCAG
TCTGGATCCAGCCCTGCATCCTTCCCGCAGCAAACATTAT
TACAGCAAAGGAGAAGACGGTTTGTTAGTCCTGGGTTTAA
AGCACTTCGCACAAACAGAGTTCCCATATCAACTGATTAG
CCGATATCTGATTCGGCCCAAGCGTCAGGAGCAACTGCGT
ATGCGAGTAAAGGACATGGTATCCCCCAAATACCCACACA
ATATCATCAAGTATTACTGCCAGAATCATGTGGTTCCTCC
TTTGCCGGTGGTGTGCAAACCTGTGGTGCATGGAGAGGAG
CGCCCTCCTGTGGAGAGAGAACAGGAAGTCATGCCCAACT
GGCTAAAGAAAAGCTTACCATTGATCCAGAAGTCAATTTG
CCAGAGCGATTTAACGATGACTTCCACCACGAAATCTGCT
AGCCTTCCTTTCCCTAAAGAAACACGCTACCCACAGTTCC
TCCCTAAAGGTCTCTCTCTGCGTTTGCACCCATCACAAGT
GGCAAGTCGCCCTTCCCAGCCCAAATCTCGAATTCTGCGT
GCTTTTACTAACCGTACACTCGCACCGTTAGCTAAAGCTC
CATCGTGTCCCACAGGTACAGGACATTTACTGACCAATAT
CTCCACACCAGTACTATTACTAGCCCAAGCGCCTAGCACT
CCTATAAATGGGGTATTTCCATTAGTCCATCCCTCTTTGA
CCCCAGCCCATGGGACAGTCCCACTAAACGCTTCCTATCC
TATTAACTTCCATTATCTTTCTCCAGAATTGGGTGCAAGT
AATCCAGCACACCTTCCTGCGAATTTACCCCCCTCGGTAG
TTCAGAAACCCCAATGTGACGTCCCTCTACTTAGTACTGG
GACAGTCAAGACCCATGGCGTGCAGCAACAGACATCAGAC
AAACACAAGAAGCGTACCATGCCTAGAAAACTGGCCCCTT
TGAGACCAGCCCCTCAGCTGCCCCGACTGCTGCCCCTTTC
TTCTGGGAGTATTGGAAACATAAGCAACCCTGGCATCATT
ATAGATCAGCAAATATCCTTGAATGTCCCACACAACCTTC
AATCAGATAACGTTATAGTTATCAAAGCCCATGAAAATGT
CAACACACACAGAACGGTCCCTTCTCTGTCTCCGGATCTG
GTTGTACAGTTAGTTCCTCAAACACAGGTTGCTGAAAACA
CCACAAGTTCCCTCCCTAGAAAGACAACACCGAGATCAGA
CGTTTCACAAACTGCAAAAGACATCCCTTCAGTTCAATCC
AGTGGCGAGAATGGTCAAAGGACTGTATTTTCTCCTCAGA
CCGCAGCACCAGCTGCAGTGGACAGTTCTCAGTTTGTGCT
GGTTCAGACTGTTTCTCCTACTGGGCCTCCTCAATTCCTA
CTTCTGCCCCAGGACTCCCTTGTCCTGAACCAACCTGCTT
CACTTCCTTCTGAAGGCACATTGCAAAATCTTTCGCAGCA
GACCTCTCATTTAGACATTTCTACTACCTCAACAGCCCTG
AAGAACTCAGAGAAGACTGAGGTACATTTGAACAACCCAA
CCACATCATTGCCAGTTAGCAGAGAGGAAGATGGAGAAAG
ACAGGAGGTGGATGAGGAAATGGTTGGAGACAGATGGGAA
GAGGAGATGGCCAGTGCTTTGTTTGGTAGTCCTCTTTTGG
CGCTTTCTGAGTCCTCCTGCAGTCCTGACTCCAGCCCAGA
TGCAAGTATGGACAGTGGCAGTGATGCCATGGTGAGGGTG
GAGATGGAAGATGGAGAGCTTCCTTCTGTACACTCAGCCT
CCGCAACACAGGAAACACCGGATGTGCACAAACACAGCAG
CGGAGATGAGAAAGAGCAACAGTCCAGTGGAGGAGAGAAG
CAGAACAGTGGGAATGAGGAGGGACGGGCTGAGGAGAGCG
AGAGTAGGAAAGATGAAGCGCAGGATGAAGATAAAGGAGG
AGAAAAGAACGAGGATGGAGAAGGGGACGGAAAACGGGAC
GAGGGTGGAAGTGGTGATAAAGGAAGGGAGGAGAAGGATG
GAGATGGAGAGAAAGATGGAGATGGAGAGCGAGATGAGGA
AGAGGAGGATTTCGATGACCTCACACAGGATGAAGATGAG
GAGGAAGTGATGTCATCGGCATCTGAGGAATCCGTGCTGT
CTGTTCCAGAACTTCAGGAGACGATGGAGAAGTTGACCTG
GCTGGCATCAGAGAGGAGACTGTGCAGAGAGGGTGACTCA
GAGGAGGACAATTCACCCACGTCCCCAACATCCCCGACTT
CCCCCAACTCCCAGAACTCCCCAGCATCGCAGAATTCTCA
GGAAGAGAACTCGGAGGATGAGGATGATGGGGCGATGAAG
GGTGATGAGCTGGAAGCAGGGGAGGGAGAAGGCGAAAAGC
TTCCTGAGGGGGACGCCCCAGCGGGTGATGATCCTCCACA
GATCAGCGAGAAAGTAGGAGGCCGTGGAAGAGGTCGTGGT
CGCCCTCCTCCGCGCAGTTTAAAACGTGGGCGACGTCAGG
AACGAGGCAGTAAAGATGCCTCAAAGCTGCTCCTGCTGTA
TGATGACCACATCTTGGATAATGACCCAATGAGAGAAAGC
AAAGACATGGCTTACGCACAGGCTTATCTCAACAGGGTAC
GTGAGGCTTTACAAGATGTCCCAGGAAAAGTGGAGGAGTT
TTTAGGTCTGCTTTATGAGTTTGACCAAGCCGGAGAGAGC
CACAGTGTTATAGAGTTGTTTGCCCAGCTTAAACAGCTGC
TCAAGGACTGGCCTGAGCTGCTCAAGGACTTTGCTGCTTT
CCTTTTGCCCGAACAAGCGCTGGAGTGTGGACTGTTTGAG
GAGCAGCAGGCCTTTGAGAGGAGTCGGCGGTTTCTGCGTC
AGCTGGAGATCAGTTTTGGGGAAAATCCTTCTCATTATCA
GAAGATTGTCAGAGCCCTGCAGAGTGGAAGTCCTCTCAGT
CCTGCTGGCATTGAAGAGCTGAAAACACAGATGGCCACTC
TTCTGAAGGGTCACACACACCTTCAGGGAGAGTTTTGGAT
GTTTTTTGATGAGATGCGTCCACCACCAGCACGTCCAGGC
CAGTTTGAAGAGGCTGTTTGGCCAGAGGATGTGGCCACTG
GGACAGATGGAGAAGCAGGCGTGAGTGTGACCTCTAGAGG
AGGTGTATGGGGAGGATTTGAGGAGGTCACGCTCCCCGAT
CTGGATGAGGATGAAGAGTCACACAAGATCAGACAGATAA
GCAGCAGAAGCAAGAGGAGAAAAGAACTGCACACATACAA
GGACTGTGATTGGCCTGAGAAAGATTGTTCCTGTTCCTGT
CATGACTCCGTTCATGATGCCAAACATCGAAGGCATAAGA
GAAAAGGATGCTTGCGTTGTCAGAGCAACAAGGCTGCTAA
TGGCTCAAAGGTGCTGAAGGGTCGTGATTCAGCATTTTCA
TCTGCCGATGCACAGTCTGAAAGAGGAGGAGAGGAAAAGG
AAGAGGAAAGAGTGCTGGGAGAGGATGGAGAGGCAGAGAA
AGAGCTTAAAGACGAGACTGGCAGTGGAGCTAACAGTCCA
CATCATGATGGGGAAGGGTCTGTGTGGGAGAGAGAAGAGA
GAGCCACTTCCTCCATTCCAGAGGAGCAAAACACACATAA
CCAAGATGATGAAGAAAAAACTGAAGAGAAGAACCACCAT
GCGTCACCAGAGAAGCACAGCCGAGATGAAGAGGATTCAG
CTGAATCTGGACAGACAGAAGCCGCTCAGCAGAGCTCACT
GAGCCCAGCCTTAGACGCACCCGTGTGTGCCAAAAACATC
TCCCTCACACCCACTGGAGAGAGAGTCATCCTGTGGACCA
GGGAGGCTGATCGAGTGATCCTTACCACCTGTCAGCAGCA
AGGAGCCAGTCAGAGCACATTCCAGGCCGTGTCCGAGCAG
CTTGGCAACAAAACAGCCAGCGAGGTTTCAAGGAGATTTC
GGGATTTAATGCGTCTGTTCCACACGTCAGCTTCTCAGGC
CAGTTCAGAGGACGAGGCTGCAGAGCAGCAGTCGGCCACT
GATGAAGAGCAGGACTGAACCCTGCCTTCTGACTGCTTCA
TTAAAAAATACTTATGCAGTTCTTCTTACACTGACACCTG
CCAAAGATGTGTTTTAAGCATGGTGGAAAAAAAGGTTCTG
TTGGCCTCCTTTTAACATGTGAAGTATAAATCCATCATAT
GAAGGTGCTATCCGTCACGTTCTAAACACAAAACCAACAT
AATTATTGAAGAAATGTAGCACAAACTGCTCCATTTTATC
CCTGATTATTGTATTGTAATTGGACAAATGACAGGCTCTC
ACTTAGCACAAAATGAGATGTTTGATAGCAGAGAAATTGT
AGAGCACTAACCAGCATATTCTCACCTCCATGGTTTCTGA
CAGGTTGATTGTATATTCTGTGAATATGTGAACATATGGC
ATGTACAGTATTTTTATATCAGGGTGGTTTTGTTGTTTTT
ATTTTGCTTCAGATGTTAGTTTTGAGAATGGCGCACAGTT
GTTGGTAATCCAAATAATAAAATGACTATTTATACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations