Transcript

slc30a5-002

ID
ZDB-TSCRIPT-110325-1587
Name
slc30a5-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050164 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050164|OTTDARG00000035275|ZDB-GENE-040718-6 slc30a5|no_translation slc30a5-002 LG_ BX571667.5 Danio rerio protein_coding KNOWN, 748 bp
CAGATTTATGTGATCATTGATATTATGCTTTGCTGAATAA
TCTCTGGGATCATTGTGATTAACTGTCATTTTCTGAGCAG
GGTGGAGTGGTTCTGCTGGTTTTAGCTTTGTGCCTGAAGG
TTGCTTTCAACACAGCATCTAGAAAACTATCTGTGGAGAT
TGGAGGTGCAAAACGTTTGTATGCTCTGTCTAATCTGGTG
TCAGCTGTAGTTCTTCTACCCTGGGTCATAGTGCTGTCTG
CAACCACTGAGAGTAAAGTGGAATCCTGGTCTGGTCTCAT
CTTTCCATTTGCCATGATCATCTTCTCTGTGATGATACTG
GATTTTTATGTGGAGTCCATCTGTATGGCAAAGCTGGAAA
CCTCTCGCTGTGCTAGATATGGCGCCATTTTCCTGTTCCT
CAACGGCCTATTGCTGGCAAACTTCTGGACCCACCCACTA
ACTGGCCAGATTAGAGCCATAAGTACCACTGGCCAGCAAA
GTAGCACTGAGCATGTGCTGTCTGGTGGAGTTCTGGTCAG
CGCATGCTTCTTCATTATGGCTGATAGCATACTGTCAGCT
CCCTCTTCAAAGGGTCAGAAAGGGACATTGGTGGGTTATT
CCCCTGAAGGGACTCCTCTGTATAATTTTATGGGTGATGC
GCTTCAACATACATCCCAGTCTTTGCCACGATTCATCAAA
GACTCACTTAAACAGATCCTGGAGGAATATGACTCAAGGC
AGATCTTCTACTTCCTTTGCCTCAACCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations