ZFIN ID: ZDB-TSCRIPT-110325-1522
Transcript Name: ca10b-201
Previous Names: ca10b-001, dkey-15h19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049842 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049842|OTTDARG00000035065|ZDB-GENE-080815-2 ca10b|OTTDARP00000039104 DKEY-15H19.2-001 LG_none BX890565.9,BX890590.11 Danio rerio protein_coding NOVEL, 2003 bp
CCTGCAGAAGGATTAGACCGCGCTAAACCTCAGATCCGCG
CGCACTGTCAGGTAACGCCGCAAACACCGTCCACGACTCA
GCCAACAGCACAAACAACGACAAATAAACACACTGGCTCG
CTCTCGTACGCTTGAGGTCAGGACTTGGAAGTTTCCACGC
TGTGAACTGGCAAGTGGTTGTCCGTGCGGTACATTTTGCG
AGTGAATCTACGCGGCGGGTCGCGTCTTTTCGGAGAGGAC
GATGTTCATCATATTTGAGAATGACGAGAGCGCGCGTGTC
GGCGACGCTCGCGGGGAATGACGCTTCAGACTTTGACCAA
GTGTTATCAAGTTAATTACCTGATGGACTAAATGAAGAAT
GCCGCACGTTTGGGAGTTCGTTCTGATTCTCAACATTAAT
GTCATCTTTGTGGAAGCACAGCCAGTGTCATCAAAGCTGC
ACGATGGTTGGTGGGCATACAAAGATGTTGTCCAGGGGAG
CTTTATACCAGTGCCGTCTTTCTGGGGACTAGTTAACACT
GCCTGGAATCTGTGCGCGATTGGGAAGAGACAGTCGCCGG
TCAACATTGAAACCAGTCGCATGATTTTTGACCCCTTCCT
CAACCCGCTACGACTCAATGCAGGGCAACGCAAGGTCAGT
GGAACGATGTATAACACGGGCCGGCATGTGTCACTGCGCC
CAGACAAGTCACACCTGGTGAACATCTCTGGCGGGCCGCT
GAGCTACAGCTACAGGCTGGAGGAGATCCGGCTTCACTTT
GGCAGTGAGGACAATCGGGGATCAGAGCACCTGCTCAATG
GCCAGGCCTTCCCTGGAGAGGTGCAACTCATCCATTATAA
TCAGGACTTGTATTTAAATTACAGTGATGCCGTCAGGAGT
CCTAATGGAATTGCAGTTGTTTCTATCTTCATGAAGATTT
CAGAGCCTACCAATGTGTTTCTAAACCGTATGCTGAATAG
AGAGACCGTTACGAGGATTACATATAAGCATGATGCATAC
TTATTGATGGGGCTGAATATTGAGGAGCTGTATCCCGAAA
CCTCACGGTTTATCACTTATGAAGGGTCGATTACTATTCC
ACCGTGCCTTGAGACAGCTACCTGGATATTAATGAATAAG
CCAATTTACATCTCACAGATAGAGATGCAGTCTCTTCGTC
TCCTCAGTCAAAACCAGCCGTCTCAGATCTTCCTCAGTAT
GGGTGACAACATGCGGCCGACCCAAACTCTGCACCAGCGC
TGCATCCGTACCAACATCAACTTCAGCCAGAGGCGGGACT
GTCCCAACAACCGCATGCTGAGGCCACAATACAGAGTGAA
TGAATGGCTTCTGAAATAAAAGCTTGACGTGGATTAGTTA
CTTCAGAAACCTGTTTGACGGACAGAGGATGATGGGAAAC
ATGCTGCGAGGTGAAGACAAAGGACTTCAATAAAATATAT
GAAATTACTTTTTTACTTGTTTATATATATATATATAAAT
ATCTCTCAAAGACATTGCTTAGTGCGTTGAGTCAGACAGG
ACTGGTTGCTTCATCTTCGCTTCTTGAAGTACTGTTTACT
CTTATTGTTTGCATCTGAAAAAAAGCAGGTGCTTTCAAGA
CTTTTGCAGCGAATGGAAAACTACCTTTGCTCTATGCACA
GGGATTTCAACTTTACTTGGACACCAGGCAAACAAAAGGA
TTTCAAGCCTATATCTTGGACTTTTTGGAGCATGTTGCCT
TCTTTACGTAAGTGTTTACAGTGCTAAATGGATTGAGTGA
GTATCTGCCCAATAAATCTTTGAAGTGGTCATTGTGAATG
TTTTTCTTTACTCTGTTTATGAGCCTGAGGAAAAGCACAG
AGCAGCAAAGCTGATGCCAATGGACTGCCAATCAAGTTAA
TTCAGTCTGTTGAATGTCGTTGAATAATATTATGAATAAT
GTTGACAGCACTCAAATGGGATGGATTCACATTTATTATA
TAATGCTTTTAATGAATATTTATGGGGTGGTGCATTTGTA
ATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ca10b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049842 (1),  Ensembl_Trans:ENSDART00000055264 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC107833 (1) 1250 nt
GenBank:EH583744 (1) 524 nt
GenBank:EH601168 (1) 504 nt
CITATIONS (3)