ZFIN ID: ZDB-TSCRIPT-110325-1513
Transcript Name: ifit15-201
Previous Names: ifit15-001, ifit2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049812 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049812|OTTDARG00000035053|ZDB-GENE-030131-1055 ifit15|OTTDARP00000039080 ifit2-001 LG_ CU464131.5 Danio rerio protein_coding KNOWN, 1879 bp
TTATCAGTACCTCACTTGAAACACAGCAGCGCAAGAAGGA
AACTCTTCAAACCAAGACAAACACTGAACATTATTATGAA
TTCTTTACTGAAAAGAGGGCTTGAGAAGCTGGAGTGCCAC
TTCACCTGGGATCTGGGGCAATATCAAAATGAGCTGCAAG
GGATGAAGAGAGAGATGGACCTTGATGTCCCACAAAAAAT
CTCTTCTCCAGTCCACTATTACAACCTGCTGGGCTTCATC
CAAAAGAGTCTTGGCTCTGACAGAGAGGCGCTGGAGTCCC
TACAGAAAGCAGAAAGTGTTATCCAGGAGCAGGGAACAGA
AGAGACTGCAGTCCGGCTGCTGGTCAATAAAGCTAACATG
GCTTGGGTCCACTTCCATTTGGGAGAGCTGGAGAAGAGCA
GAGGATACCTAGAAGAGCTGGAGGAGCTTCAGAGAATTCA
TCCTGCTCCACCTGGATGCCCTTTACACCCTGAAGTGAGT
GGAGAAAAGGGCTGGACGCTGGTGAAGTTCAACAAGTCCA
AGAAGCGCCTGGCCATCGATTACTTTAAGATGGCTTTAGA
AGCTGAACCTGAAAGGAAGGAATGGCACAAAGGTCTTGCC
ATATCTATGAGCAAAGCATGTTTATGGTATAAATGCACTC
CAGAGCAGAAAGCGGAGATTTTAGAGAAGGTGAAAACGGC
AGCAGAGATCAACCCAAATGATTTGTTACTTCAGGCTCTT
TATTTAGTAAAACTTTCTTATGTGACAAAAGTAAACGTCG
AGAGAGAGATGCGAGATTTACTAGAGAGATGTCTTGAAAT
TGTAAACGTGCCGGGTTTGAATATCATTCTCAAATATTTA
GGAGACATTTCTTTTGATGAATCTATTCGTGAAGGAGAGA
GATTTCAAGAAAGGTACCCCGAATCAATCAAAGTGTTGAA
ATGCCTGGCAGACACCTACAAATGGAAGGTTTACAAAATG
AATGAAGACACAGAGGAAAGGGTGATTCTGGCTAGGAAAA
CCATTGAGCTGCTGGAGAAGGTTTGCGGATATAACCCAGA
CTCACACAGAGCAAAAGTAGCCCTTGCAGCAATGCACTAT
TACGCACACAACACTGAAAGAGCCGATGAGATTTACCAGC
AGCTCTTGTTAGAAGAAGAATTGTCTCCTGACAAGTGGCA
GTATATTTACTACTGTTATGCCAGTTATCTAAATCAGTGT
AAACGGTTCAGTGAGTCAGTACAGTTTCACATAAAAGGAG
TGAAAACCCCAGGTGATTCAGTTGACAAAGAAAAGAGTTT
AAACATTCTTAAAAAGATTGTGTGGAGAGGTAAAGATCCG
CTCTGTTCAGAAATTAGGCAATTACTCAAGACAACTCAGA
AATGATTTTGATAAATCTGATGAATGTAGTTTAATGTAGA
ATGGAGCTGTTCTCATGCAGTGTCATTTTTTAAAAACACA
AAATAACGTAAAAAATAGTGCTTTTACGCAGTGGTGGAAA
GATTAATGAAATATCATACTTAAGTAAAAGTACCATTACT
TGCCTAAAAATGTAGTGCAAGTAGAGTAAAAGTACCTGTA
AATATTACTGTAAAATTTAAAATATTAATACATTTTAAAA
TGTAATTTATGATTAATAATTTTTTTTTTTTAAATTACTC
AAAGTATGGGTAAAAAGTAGCCCTGTAATATCAGGTGACC
AAAATTCAATGTCTACCAGCGTCAACGTTATTTTGATGTC
CTATAACAACGTCAAATGATGTTGATATTTGGTTGATTTT
AGCTTGTTAGAAACAGACCAAACATTGAGCCAAGTTTGAG
TATTTGTAATTTGTTACTTTACACCACTGCTTTTTTGTCA
TTACAATAATAAAAATGTCTTCCTTTTTTAACATAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ifit15-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049812 (1),  Ensembl_Trans:ENSDART00000064003 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124131 (1) 1895 nt
GenBank:BC085364 (1) 1882 nt
GenBank:CK866455 (1) 775 nt
GenBank:CK866739 (1) 749 nt
CITATIONS (2)