Transcript

apobec2a-201

ID
ZDB-TSCRIPT-110325-1460
Name
apobec2a-201
Previous Names
  • apobec2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049560 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049560|OTTDARG00000034907|ZDB-GENE-050306-15 apobec2a|OTTDARP00000038880 apobec2a-001 LG_ CU856139.10 Danio rerio protein_coding KNOWN, 1389 bp
AGTGCTGTTATAAATACTGAGGTGTGTGTGTGTGTGTGTT
TAGTTTCAGAGATGGCCGATAGAAAGGGCAGCAGCGGCGT
CAGCTCTCGTCTGAGCGTCAGGAGGAAGGAAAAGGCAGAA
AATGATGCCAAGAAAGAGGAGAAAAGCCCAACAGAAGCGG
AGAAACCCGAAGTGAACGGGAAAGAAGTGCCGATGGAGAA
CGGAGAGGCCGGAGCTGCTGCTGCAGACGGAGAAAAACCA
GAACCTATAGAGCTGCCGCCATTCGAGACCATCACAGGGG
ATCGCATGGACCCGTTTTTCTTCAAGTTCCAGTTCAAGAA
CGTGGAGTACTCGTCCGGCCGGAATAAAACCTTCCTGTGT
TACCTGGTGGACCACGGCGGCGAAGGCCTGATGAGGGGCT
ACATTGAGGACGAGCACGCTGGCGGACACGCAGAGGAAGC
CTTTTTCCAGCAGATCCTGACCAACTACGACCCGGCCTGC
AAATACACCATCACCTGGTACATGTCCTCCAGTCCCTGCG
CCAACTGCGCAACCAAGCTGGCGGAGATCCTGCGCTCCAG
GAAGAACATCCGGCTGGCCATCTTTTCGTCGCGGCTGTTC
GAGTGGGAGGAGCCTGAGATCCAGGCAGGGCTGAAGCTAC
TAGCGTCCGTCGGCTGCAAACTGCGCATGATGAAGCCGCT
GGATTTCACCTACACCTGGGACACGTTCGTGGAGAGCGAC
GAACAGCAGTTCACACCCTGGGAGGACTGTCAGGAGAACT
ACGAGTACTACCAGGACAAACTGGCCGACATCCTGCAGTG
ATGATGATGAAGCTAGTCGACGCACACACTTGGAAGAGCG
TGTTTGTGTATGTGAGAGGAACCTGATTCATTGAATACTT
GTATGATTAAGAGAGTTTATACTTTATAATTAATGTTTGA
GTTAATCACATCTTTGTTTACGTTTTGTTCATGTTTACTT
GTCTGTGATGGACACGTTTCATATTTCATTTTTCATTTCA
TATTTTATTGTTTATTTTGCAACACAGAGGTTTTTCTTTG
ACTACAAGAACAACAAAGTACATCACATCGAAAACAATTG
CGCTGAAAATCTCTGTGTTCATGTCATCTGAATGTAGCTA
CTGTTTTCATTTAATGTATTTGATTTGTTTTCAGTATCAA
GACAGATATAAGATGGGAAAACTCGCATATTACACAAAAT
TAAGGAGGATTTTGAGCAATTTCAGTTTTATTTATGATTT
TATACTCATCGCACTCTTTCATACTGTGAATTAATCAGGT
AGTTTTGTTATAATAGCTACAAACTCAACTGTAAACACCG
TTCCTGCTGCTGCATATAAATTACATTTGTGGAAGCAATA
AACCATAAACAACCTTCACTATTTTGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations