ZFIN ID: ZDB-TSCRIPT-110325-1446
Transcript Name: ppp2ca-201
Previous Name: ppp2ca-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049517 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049517|OTTDARG00000034876|ZDB-GENE-050417-441 ppp2ca|OTTDARP00000047771 ppp2ca-001 LG_ CU633746.8 Danio rerio protein_coding KNOWN, 2097 bp
AGGATTCGTTATTTTGAATGCGGATTAGATGACGTCAACC
TACATGAGCGGATTCTTCGTCGGTGCTGCGCATCAGAGTC
TGACCGAAATCAAAGGAGCTTTTGGGCTGTAGCGTTAGTT
TTATTCGTTTACTGCCCCAAAACAACAAGAAGTTCGTCGT
TTTATTCATAGATGAAGTAAAGTAACCGTGTTTCGGTTTA
TTCCGAGGCCTTTAAAGTGTTTGAAGTAATCGCGGACTCC
CTACGGCTTTATTTCAAACCGGGGATCGATACTTTGACGC
ATGACGCTAAACCCTCGTAAATTACTGTGAGTTTTTTAGC
ATTATTATCATTATTACGCGTTTAACAGAATGGACGAAAA
GGTTTTTACGAAAGAACTGGACCAATGGATCGAGCAACTG
AACGAGTGCAAGCAACTGTCGGAAAACCAAGTGAAAATTC
TTTGCGAAAAGGCTAAAGAGATTTTATCTAAAGAGTCAAA
CGTTCAGGAGGTGCGTTGTCCGGTCACAGTATGCGGAGAC
GTACACGGCCAGTTTCACGATCTTATGGAACTGTTTAAGA
TCGGCGGTAAATCACCAGATACCAATTATCTGTTTATGGG
AGACTATGTGGATCGAGGATACTATTCCGTCGAGACAGTC
ACGCTGCTGGTGTCTTTAAAGGTTCGATATCGAGAGAGAA
TTACCATTCTCCGTGGCAATCATGAAAGTCGACAGATCAC
ACAAGTTTATGGCTTTTATGATGAGTGCCTGAGAAAATAC
GGAAATGCGAATGTTTGGAAATATTTTACAGACCTCTTCG
ACTACCTTCCTCTTACAGCCCTCGTAGACACACAGATTTT
CTGTCTCCATGGTGGATTGTCACCTTCAATTGACACGCTG
GATCACATTCGGGCTTTGGACCGTATTCAAGAAGTTCCCC
ATGAGGGGCCCATGTGTGACTTGCTGTGGTCAGACCCGGA
TGACCGTGGAGGTTGGGGAATTTCCCCCAGGGGTGCTGGA
TACACATTTGGCCAGGATATTTCAGAAACATTCAACCACG
CCAACTGCTTGACCCTGGTCTCTCGAGCTCACCAACTAGT
GATGGAGGGCTATAACTGGTGTCATGAGCGTAACGTTGTA
ACAATCTTCAGCGCTCCTAATTATTGTTACCGATGTGGAA
ACCAGGCTGCGATCATGGAGCTGGATGACACGCTCAAGTA
CTCCTTTTTACAGTTTGATCCTGCTCCACGCAGAGGGGAA
CCTCACGTCACTCGTCGCACTCCAGATTATTTCCTGTAAA
ATAGGAAGGCCTTTTTTTTTCTAATCCCAGTATTGCAGCA
TTATCTGACCAGTGGACAATGATTATTCATAGAAGACATG
CTCATCTGTTCAAAGTTTCCAACACAAACCCCTATCCTTG
GACCAAAATGATGTGCCATATATCTATACTGCAATAACAC
AGATGCAGTCATCACAAACACACTAATATAACAGTAATAT
CTCATTCTCATGGTGGCCTAATAGTGCTTAACTAACCTGA
CATTTCAGAAAGCGAACAGTAACTCACAACGCAATGACAT
GATGATCACAATGCAACCAATTAAAACAGCAAAGATCAAC
TTGAAACGCAATGACATTAAGATCACAACACGACGTTTCA
AAAAGCAAACATTAATCTCAACACTGACATCAAGATCACA
ACACAATAATTCAGAAAGCAAACAGTCACACTACACAACG
ATTAAGATCACAACGCAAGAACATTTTAGAAAGCAAACAT
TAACACAACGATATTTCAGAAAGCAAACACTGATCGCACA
ACACATTATTAAGATCACAACGCAAAAACATTTCAGAAAC
CAAATATTAAATCTCACAACGCAACGACATTTCAAAAAGC
AAACATATAGGGCTCTATTTTGACGGTCCATGCGCAGAGC
GCAAAACGCAGGGCGCAAACGCTTTCAGGGCGTGTCATGA
CGCGTTTTTGCTAATTTACGGACGGGAAAATGCGCTTTGC
GCCGCGGCGCATGGGCTAAAAGGGTTGAGTTTATTTTCTT
AATGAGTTATAGGTGTGTTTTGAGAATAAACCAATTAGAG
TCTCATCTCCCATTCCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp2ca-201 Contained in:
[Fosmid] CH1073-44G3 (1), CH1073-353O20 (1)

Genome Resources: Vega_Trans:OTTDART00000049517 (1),  Ensembl_Trans:ENSDART00000042421 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155238 (1) 2063 nt
GenBank:BC092961 (1) 1915 nt
GenBank:BC165383 (1) 997 nt
GenBank:CK684303 (1) 547 nt
GenBank:CK698922 (1) 543 nt
GenBank:BI318633 (1) 521 nt
CITATIONS (2)