header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1403
Transcript Name: si:ch73-334e23.1-001
Previous Name: ch73-334e23.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049376|OTTDARG00000034801|ZDB-GENE-110408-36 si:ch73-334e23.1|no_translation sox2ot-001 LG_none FP102167.4,CU468686.12 Danio rerio sense_overlapping NOVEL, 504 bp
GAGAGGAGAAAAGTATCGGCTCATCTCTCCGGCCGCAGCC
TTCCTCTGGGCATCACAAGATCCAGTCTTCATCGCAGTAC
CGCCGAGGAAGGAGGACGTCCGCTTTCTGCTCTTGTCGGG
AATCTAAGAAGGGACCATACTTCCCTTACGGAGGAGCTGC
CGATGGTTCATTTCTTCATGCACAGGCAGCCAGAAGATGG
CGTGGAGCTGCAGAGGGGCTGAGGCGGGTGAGAGCAGCCG
CGCTGAGAGCACTCTGAGCGGGCACACGGAGCGACTGGAC
GCTATGGATCATGAGAGCGGCTGCCGGAAAACTGCGCGGC
CGGAAAAAGCGACTCCTCGCTGGGCGCGCATGGGAGGATC
CGGCCGGCAGGCGCGGGGAACTTTTGGATGTGTCAGTCAA
ATGGAAACGAGGAGCGACACCACAGCGTTTATGTTTTGCC
TGTAAATCTCTGCTCTGCTTGGGGACATAAAACGGCCCAA
ATGCAATGAAGAACGCACGTCAAG

si:ch73-334e23.1 TRANSCRIPTS
Type Name Length (nt) Analysis
antisense si:ch73-334e23.1-001 504
si:ch73-334e23.1-002 (1) 400
si:ch73-334e23.1-003 (1) 503
si:ch73-334e23.1-004 (1) 522
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-334e23.1-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049376 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK143224 (1) 844 bp
CITATIONS (1)