Transcript

ptp4a3-203

ID
ZDB-TSCRIPT-110325-1372
Name
ptp4a3-203
Previous Names
  • ptp4a3-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049274 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049274|OTTDARG00000034742|ZDB-GENE-040426-2220 ptp4a3|OTTDARP00000038668 ptp4a3-004 LG_none CU915256.7,CU459126.6 Danio rerio protein_coding NOVEL, 639 bp
TGTAATGATCCCCTTTCTATTTCCAACACGTCTCTTATTT
TATAAGACTTTTCATTTTTAACAAATACTGCTTTTTCTGT
CAGACCTACACTCTGTCCTTCAGTAGTGGATTTGTCCATG
GCTTTCCTGCAGAGGACCGGAGATTACTGCCACGCTCAAC
ATCTGCACATCTAAACACAGGGAGAACACCGAGCTTCGCT
GATCTCTGGATGCACCGAGACGCTCTTCCCTTCACTGCCT
GTGGTCCTGCCACCCAAAACTCCTCACTAATCTAATGGGG
TGATCTTACCTCTCTGGCTACAGTAAGCCATTAGAGAGGG
GATTCAAGATATCGGGGACTTTGAGAAGTCTTGCAGTGTT
TTATTGACAAAGACAGACTGAACAGTGACAAGCTTCTTTC
GCGTGAATTGGCTTGTAAACAGTTTGGACACTTGAGTCGG
AAGGAAGCACAACTATGGCTCGCATGAACCGACCGGCCCC
TGTGGAGGTGTGCTATAAGAACATGAGGTTCTTGATTACA
CACAACCCAACAAACTCCACCCTGAGCAGCTTTATTGAGG
ATCTGAAGAAGTATGGTGTCACGACAGTGGTCAGAGTTTG
TGAGATAACTTATGATAAAACCCCACTGGAGAAGAATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations