Transcript

rpe65a-201

ID
ZDB-TSCRIPT-110325-1339
Name
rpe65a-201
Previous Names
  • rpe65a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049171 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049171|OTTDARG00000034695|ZDB-GENE-040426-1717 rpe65a|OTTDARP00000038585 rpe65a-001 LG_ FP102801.7 Danio rerio protein_coding KNOWN, 1744 bp
CTCAAGACTGCAGGAAAAAAACGTCGACGGAAGCAGCTGA
AATCACAGATAACAGTGAATACAGCAGTCATGGTCAGCCG
TTTTGAACACCCTGCTGGAGGCTATAAGAAGATCTTCGAG
ACGGCGGAGGAGCTGAATGAACCTCTTCCAGCGACCGTCA
CTGGTCGCATCCCGTCCTTTATAAAGGGCAGTCTGCTGCG
TTTGGGTCCCGGCCTGTTTGAGGCTGGAGCTGAGCCCTTT
TACCATCTGTTTGATGGACAGGCGCTAATGCACAAGTTTG
ATTTCAGCAACGGACAAGTCACTTATTTCCGCAAGTTTGT
GAAAACAGATGCGTATGTGCGCGCCATAACAGAGAAACGG
GTGGTCATTACGGAGTTTGGGACCTGTGCATATCCAGATC
CCTGCAAGAACATCTTCTCCAGGTTTTTCTCATATTTTAA
GGGCGTTGAGGTGACGGACAACTGCCTGGTGAACGTGTAC
CCTATTGGGGAGGACTTTTATGCTGTCACAGAGACTAATT
ACATCACTAAAGTTAATGTGGACACTCTGGAAACGCTAAA
AAAGGTTGACATGTGTAATTATGTGAACATCAATGGAGTC
ACGGCGCATCCTCACATCGAGAGAGACGGGACGGTCTACA
ACATTGGGAACTGCATGGGCAAAGGAGCGTCGCTGGCCTA
CAATATCGTCCGAATCCCACCTACACAAAAGGACAAATCT
GACCCCATTGAAAAGTCCAAGGTGGTTGTGCAGTTCCCAA
GTGCCGAGAGGTTCAAGCCATCCTACGTGCACAGTTTTGG
GATGACGGAGAACTACTTTGTCTTTGTGGAGACGCCTGTG
AAAATCAACCTGCTGAAGTTTCTGAGCGCCTGGAGCATCA
GAGGATCCAACTATATGGACTGCTTCGAGTCGGATGAAGA
GAAAGGCACCTGGATACACATTGCGAGGAAACACCCAGGA
GAGTACATTGACTATAAGTTCAGGACCTCGGCGATGGGTC
TTTTCCATCACATCAACTGCTATGAGGATTCGGGGTTCAT
CGTGTTTGACCTGTGTGCCTGGAAAGGCTTTGAGTTTGTC
TACAACTATCTGTGGCTGGCGAACCTCCGCGCCAACTGGG
AAGAGGTTAAAAGAAATGCCATGATCGCCCCGCAGCCAGA
AGTCAGGAGATACGTCATTCCTCTGGATCCCTTCAGGGAG
GAGCAGGGCAAAAACCTGATCTCTCTGCCCTACACCACAG
CCACTGCCACAATGCGTGCAGATGGGACCATCTGGCTGGA
ACCCGAGGTGCTTTTCTCTGGCCCACGTCAAGCTTTCGAG
TTTCCTCAGATCAACTACAGAATGGTCAATGGGAAGAATT
ACACATACGCCTATGGACTGGGACTCAACCATTTCGTCCC
TGACAGGATTTGCAAGCTGAATGTGAGGACTAAGGAGACC
TGGGTATGGCAGGAGCCCGACTCGTACCCTTCGGAGCCGC
TGTTTGTACAGACTCCTGACGGAGTGGATGAGGACGACGG
TATCCTCATGACAATCGTGGTGTCTCCTGGAGCCCAGAGA
CCGACATACTGCCTGATCCTAAATGCTAAAGATCTGTCGG
AGATCGCCAGAGCAGAGGTGGAAATCCTGACTCCGGTCAC
TTTCCATGGGATGTACAAACCATAAACCCGCTGAACACAC
TAGCACTGATCCTGACTGACTGTAAACTCCCCAACACTGT
AAACAATAAAGCTATTATACTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations