Transcript

pip5k1aa-201

ID
ZDB-TSCRIPT-110325-1334
Name
pip5k1aa-201
Previous Names
  • pip5k1a-001
  • pip5k1aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049156 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049156|OTTDARG00000034688|ZDB-GENE-050522-517 pip5k1aa|OTTDARP00000038576 pip5k1a-001 LG_ CU855694.7 Danio rerio protein_coding KNOWN, 2908 bp
AGCGCAACAACGTCACTTCCGCTTGTTTTGGGAGGCTTGA
TGAACGAAGGAGGACGTTTCCGTGCGGTTCAGCAGCGGGT
TATTTACTTCGGAAGAGCCCGCTAAAGTAACAATAGCAAC
AATTTCGAGCACCTTAAAGATTCCCGCAAGGCACAGATCC
GTTCTGGGAACAGTAAACAAAAGTTAAACCACACTGGTTT
GGATTTCTGAATAAAAACGGAGTAAATAAGTTAAGGGCTG
TGGGGTAAAAACCACAAGTGAAAACAAAGCAGGACCATAT
GAAACTTCCGCCAGAAAATGGCTGCGCCGGCTGTAGTTTC
CACGGATGGAGCAGACTCCAGTACTCCTGGAAATCGAAAG
ATGGCGTCTTCAGAGGGTCTCAGCACCTTGGGTTCATCCC
AAACAAACAAAAAGACCTTGGGTCACCGAGGGATTGACCC
CACTGGGGAGACCACATATAAAAAGACTACATCATCTGCA
CTGAAAGGTGCCATTCAGCTGGGAATCACACACAGTGTGG
GAAGCTTGAGCCAGAAGCCAGAAAGAGATGTGCTTATGCA
GGACTTTGAAGTGGTAGAAAGCATCTTCTTTCCCAGTCAA
GGAAGTAGCTCAACGCCGGGTCATCACCACGGTGACTTCA
AGTTTAAAACATACGCTCCCATTGCATTCCGATACTTCAG
AGAGATGTTCGGGATCCGACCTGATGACTACCTGTACTCT
CTTTGTAATGAACCCCTTATCGAGTTGTCTAACCCTGGAG
CGAGCGGGTCTCTCTTCTACGTTTCTAGCGATGATGAGTT
TATTATTAAGACGGTACAACACAAAGAAGCAGAATTCTTG
CAAACACTCCTGCCAGGTTATTTCATGAACCTGAACCAGA
ATATGCGCACACTGCTTCCCAAGTTCTACGGCCTCTACTG
CGTTCAGGCTGATGGGAAGAATATCCGAATTGTGGTGATG
AACAACCTGCTGCCACGCGCTGTACCCATGCACCTTAAAT
TTGACCTGAAAGGCTCCACATACAAGCGACGAGCTTCACC
AAAAGAGAGGTCCAAGGGTGTGCCCACATATAAAGACCTA
GACTTCATGCAGGACATGCCTGAGGGCATATTGCTGGAGA
ATGACCACTACACTGCCCTCAGCAGGACCATGCAGAGAGA
CTGTCGGGTACTACAAAGCTTTAAGATCATGGATTACAGT
CTGCTGGTGGGTATCCATATTTTGCACCGGGCAGGTGAAG
AGGCATCTACGGCAGTGCCTGATACCCAGAAAAAGGGGCA
AGGCCAGAAGCCCCTGTATTGTACTGCCATTGAGTCAATT
CAAGGGGAATCAAAGAGCAAGACTTCACCGCAGCCCTACG
AAAGCATGGGAGGAATTCCAGCATTCAATTCAAAAGGAGA
AAGATTGCTGGTTTTTATTGGCATCATCGATATACTTCAG
TCTTATAGGCTTGTAAAGAAGTTGGAGCACTCGTGGAAAG
CTCTGCTGCATGATGGGGACACTGTATCTGTGCACCGGCC
GAGTTTCTATGCAGATCGTTTCCAGAAATTTATGTGTAGC
ACCGTCTTCAGAAAATCGCAATTGAAAACTTCTCCCTCAA
AGAGAAGCCGCTTAGGACCCGTGTCTGCTGGGAAGAAGTC
AAACATTGCAGTATCTGGACAATCACATCAACAATCCCTT
CCTGTAGCAGCAGAACTAACCCAGTCGCAGCTGTGGAGCA
GTGAGGACCCTCAAGGAGACAGCGGTATGCAAACCGCTCG
TCCAGACTTGCTTCCTCAACAGGTTGCTGAAGATGATATC
ACAAGCAGCTCGGCTGATACTACCCTGTCAGCAACCTCTC
TTGTTAACTCTCGACTCTCCACAAACACTCCAGTTCTCAG
CCGCAGCAGTGTAGCTGGTCATTCATCAGAGGAAAGTTTG
GACATGGACGTCATTTCACTCAGCGAGATTGTTCCTCAGA
CAAGCACGTCAGAATGAAAGACTGTGGACGAACAGGTCGA
AACAAAGCCCTCAAGGACAAAGTTTTCTCTCTTTTAAAGA
CATCAGAACAAGAAGAAAGTGGAAAAACAAGATGGAGTTG
TGCAAGCACGAGGGGAAGTGAAACTGAAAGAGTCTGGAAT
ACAAAAGAGAGAAGTGCACATGTTCATAAAACTGTAAAGA
TATTCCTCCCCTTTTTAATAATTTTTATTTTTGGATGTCA
ACACAACGGCATCCAATATTGCTGCTAAGAAATGGACCCA
AAAGAAAGACGTACCTCAACAGTGTGATCACTGATGTCAA
ACAGGGACATACAACAGCAGTGCCATATATACAAGAGCCT
CCAGAACAGACATAAAGTCGTGAACTGCATCATGTGAGGC
TCTTGGAGAAGAGTACCTTGTGAGTTTTATTTGACCATAC
TTTTATTAGTCTGCTGCAGTCGTGTTCTTTAATTCCCCAG
AGATAAAGAGAAATATTTTTTCGTATATTTTAAAAGGTTT
TATGTAGTATAGCGTGGTTATCGAGGGGGGGGAAGTAGGA
TGGTTTAATCCAGATCAGGTTGCCTGAACAATCACGTATC
AAGACACTTTTTCAAAACTTTTAATCCGTAAAATGGTTTA
GATTTGGTTTTAAAAATGAAGTTAAATGCAGTACTGAGGT
GTTGTGTTGGATTTTGAAATGTGCCTTAACTACAGGAGTT
ATTTTGCCTTACTGCATCTTTTTATTGGGCACGTTGCCTG
CTAGTGGATTATGCAGGTTTCTAGGTTTTCCTAAATCACA
GCTCTGCACAGTTTAGCTTTAACCCTAATTAAACACACCT
GACCAGACTAATTGAGTCCTTCAGGCTTGTTTGAAACCTA
CAGGCATGTTGCTGCATCTTAATTCGCATACTTGTACTAC
ACCCTAAAAGTATGTACTTTTTTGTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations