ZFIN ID: ZDB-TSCRIPT-110325-1242
Transcript Name: cyth4b-201
Previous Name: cyth4b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048862 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048862|OTTDARG00000034524|ZDB-GENE-080219-45 cyth4b|OTTDARP00000038347 cyth4b-001 LG_none FP102159.10,CU929440.3 Danio rerio protein_coding KNOWN, 1752 bp
AGACATGAGCACAAACACACAGCTTTCACCAAACAAACAA
TGATGGAGTGCAGCGACACAGAGCTGACGGTGGAGGAGCA
GATGGAGATCGAGCGGCTGAAGATCCACAAGCAGATCCTG
CTGGAGGACATCGAGAAACTGAAGAGTCAGATTGAGAATG
TGATGGCTGATATTCAGGACTTCAAGTCGGCAGAAGACAA
TAAGACACTGGAGAGAGAAAAACGCTTCAGCAGTGGAAAG
AAGAAATTCAACATGGACCCTAAAAAGGGCATCAGGTTTC
TGGTGGACAACGGTCTGCTGGACTGGAAAGCGGAGCGCGT
GGCAGAGTTTCTGTATAAAGAGGAAGGTCTGAACAAAACG
GCCATCGGAGACTTCCTGGGGGAAAGGGAGGAGATGCACT
TGCAGATTCTCAAGGCGTTTGTGGAGCTGCACGAATTCTC
TGACCTGAACCTGGTGCAGGCCTTACGGCAGTTTTTATGG
AGTTTCCGTCTGCCGGGTGAAGCGCAGAAGATCGACCGCA
TGATGGAGGCCTTCGCCACGCGCTACTGCAACTGCAACAT
CAGCGTCTTCCAGTCCACAGACACGTGTTATATTCTGTCG
TTCGCCATCATCATGCTGAACACCAGTCTTCATAACCCCA
ATGTAAAGGACAAAACTACGCTAGAGCGCTTCATTAGCAT
GAACCGCGGCATCAACAACGGAGAAGACCTTCCTGACGAC
CTACTGACGAATCTGTACAACAGCATTCGCAACGAACCGT
TCAAGATCCCAGAGGATGATGGGAATGATCTGACCCACAC
TTTCTTCAACCCAGATCGGGAAGGATGGCTGCTCAAATTG
GGCGGTCGTGTGAAGACGTGGAAGCGCCGCTGGTTCATCC
TGACTGATAACTGCCTGTATTATTTTGAATACACCACGGA
TAAAGAGCCACGCGGGATCATTCCTCTGGAGAATCTGTGT
GTCAGAGAAGTCATCTTTCAACGCAAACCGTACTGTCTGG
AGCTCTACAACCCCAACAGTCGAGGGCAGAAGATCAAAGC
CTGTAAGACGGAGACAGACGGACGCGTGGTGGAGGGAAAA
CACCAGTCATACACCATCAGCGCATCTACAGCGGAGGAGA
GAGACCAGTGGATAGAGTCCATCAGGGCCAGCATCACTAA
AGATCCCTTCTATGATCTGGTTTCCATTCGCAAGAAGAAG
GTCACCGGTAAAGCAGCTGACAAATGAAGAAACTCTCTCA
CACACTCTGAGATACGAGAGCGCGCGCTGGCTTCATCAAC
AAACACTGATGATCAATCAGCAAAGCAGCTGCGGATCAAT
AGTGACTGTAAAGTAAGACTGATCAGCTGGGGTCAGTCAC
TCAGTGTTAATACTGCGGTGTTCCAGCAGAGATTTCCTCA
TCTATACTCACCCCAATGCTGGAGATTACACACACACACA
CACACACCTGTCAGCTCTGCATGGATATCTTCACACTCGC
TTTATTCTCAGGGACTGACAGCAAAGAAAGCAGCAGCAGC
GAGGAGAAGCACAACATCACACACGCTGACTGAAGGTTTA
TCAGCTGTAGTTCAGAATGCTGTGGAGGAAATGAGTGGAG
AGATTACTATTGTAAAGTACATGTGTGTGTGTGCGCGTGT
GTGTGTATGTACTGATGTAAAATATATATGTAAATATTAT
AGATCTTGGTTGATAGTAGCTGATGAATGTAAATTTAATT
ATTTAATTAAAGTTATTTCAGTCTCCGTGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyth4b-201 Contained in:
[Fosmid] ZFOS-169G10 (1), ZFOS-2694G8 (1)

Genome Resources: Vega_Trans:OTTDART00000048862 (1),  Ensembl_Trans:ENSDART00000163142 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154839 (1) 1759 nt
GenBank:EV758575 (1) 1000 nt
GenBank:EH453546 (1) 945 nt
GenBank:CD283131 (1) 502 nt
CITATIONS (2)