Transcript

gbx2-201

ID
ZDB-TSCRIPT-110325-1212
Name
gbx2-201
Previous Names
  • gbx2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048694 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048694|OTTDARG00000034418|ZDB-GENE-020509-2 gbx2|OTTDARP00000038196 gbx2-001 LG_ CR847983.11 Danio rerio protein_coding KNOWN, 2095 bp
CACAGCTGATGCTGCGAGGAGCAATTTATTGTGACTTCCA
TCAGGTCGAAATGAAACGCGGCCAAGCAGAAGGGACAAGG
ACGCTGAAATAACTCAAGGGAGGACGATAAAGCTCATGTG
AGATGCTCGACCTTTTTCTCGCCCAGACTTTTCTCAGCCA
GGGAGTTGTCTGTGTTTCAATGCACTTGTCTCGCTCTGTT
CTTACGGCGAACTGGCTCTGAATCGAGGAAGAAGAAACAG
ATGCAACGGTTTTATGAACCGCACACACAGAATCGTTCAG
AGGATTACCAAAAGCTCAGAGAGTGTCAGTGTATGACGCT
GTCCAGCAGTGAGATTCCAATCTGAGAAGCGCAGTGGAGA
AAGCTTCTCCCAGACTTCAGGACTTCAGAAATTGTCCACA
TTAGATCATATGAGTGCAGCTTTCAGCACACCGTTCATGA
TGATGCAGCGTCCGGTGGGAAGCACCACTGCATTCAGCAT
TGACTCGCTCATCGGCGGTCCGCCGCAGCCCAGTCCGGGA
CATTTCGTGTACACAGGTTATCCCATGTTCATGCCATACC
GGTCAGTGGTGCTTCCTCCGCCGCCTCCTCCACCCCCTCC
AACACTCCCCCAAAGCGCTCTCCCTACGACCCATCCGCAC
CACCCGATCCCGGGCTTACCCAGCAGCTTCTGCTCCAGCC
TGGCGCAGGGCATGGCACTCACATCCACGCTAATGGCCAC
GTTACCCGGCGGCTTCTCCTCCTCGCCGTCCCAACAGCAC
CAAGACGCGGCGAGGAAGCTCGGCTCTCAGTCTATTCACG
CCATGTTCGACAAATCTCAGGATATTCGTTTGGATGGAGA
GGATGGGAAAACGTTTGCGACGAAAGATTCGACGAGCATT
CCGTCCTTCCACGATTCGCAGTCCGTACACACCTCTACAG
TGCGAGGTCACAGCAAAGACGACTCGAAGGAGGATGATTG
TCACAGGAAAGACGAGAGCTTCTCCATGGACAGTGATTTA
GATTACAGCTCCGATGATAACGGGCCCGGGAACGCCATGT
GTCAGAAAGAAGACGGAGACGGCAGCGGAGGTCTGGACGA
CGGCGTTCACGGTGGGAATGGGGCCGGGAACACCACATCC
ACTGGGAAAAATCGGAGAAGGAGGACCGCTTTTACGAGCG
AGCAACTGTTGGAACTGGAGAAGGAGTTTCACTGTAAGAA
ATATCTGTCCCTCACAGAACGCTCGCAAATCGCGCACGCC
TTAAAGCTCAGCGAGGTGCAGGTCAAGATCTGGTTTCAGA
ACCGGAGAGCCAAGTGGAAACGGGTCAAAGCGGGCAACGT
CAACAGCAAAACCGGAGAGCCATCCAGAAACCCCAAAATT
GTGGTGCCCATTCCGGTGCATGTTAGTCGGTTTGCGATAC
GCAGCCAACACCAACAGTTAGAACAGGCCCGACCTTGATA
CACAGGGCTTTAGTTTCCACAGGACAAATTGGAGACTTAA
ATCGGCCAATACTTAATATGACCAACCTTTTCTTGAGAGG
AAACAAGTGACAGTTTGGCTGATAGTTTGTGCCATATATA
AATATCATTTCCGTGGAAAAAGAAGCTCGAAAGAAAGCTT
CAAACTAAGACCTCTTACTGGGAGAAAACTGCTGTTTTAT
TTCCGACTTTGGACCAAATCACGAACACATTTTAGTTATT
GATATTCCACTGTGTATTTAAAAGAGATAATTGGTTTTAC
GTTTAGCTTTGTGTGACTGTCTAGTTCGTGTGTTTATTGG
CAGAGATGAACATTATCCCAAAAGGAGCACTTCTGGTCTC
TGCTGAAGCACATGATATAATTCAATTAATAGTCAAGTTA
ACACCATTCCCTCGGATTTAAAAAAACAACCTGTTTAAAA
AAATGTGCTTTTCTTTTTATGGTCAAATCTATTATTTTAA
CGTTTTGCTTTGTTTTGTTTTCTTGCATTCGTTTCCCTTT
TCTGTAACCATTTAAGACATCACGGGCACGCTGCTAATTT
ATTTAATATTGTGAGAAGAAAACCTGCTAACGTTTTATCA
TGAGTTTACTTCAGAATATTGTGTGGATTAAAGCTGGACC
ATAAACAATTGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations