ZFIN ID: ZDB-TSCRIPT-110325-119
Transcript Name: ibtk-201
Previous Names: ibtk-001, ch73-167f23.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047934 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047934|OTTDARG00000033987|ZDB-GENE-030131-6246 ibtk|OTTDARP00000037617 CH73-167F23.3-001 LG_ CU929362.9 Danio rerio protein_coding NOVEL, 1877 bp
ATGCCTCAAATAGCTCTTACTTAACCGTCTAACTCTGCGG
CAACATATTTAGCGTTATTGTAAAACACCAATATTCCGTT
TAAAGATGTTTTACTGGATTTGCCGTAAAGATGGAAACAC
AAACAAGGCCCTTTCTTTCATCTAGCATCAGGGACCTTTT
GCAATTATGGAGGCCTAAATGTTGAATAGATTTGGGGGGA
AGGAGTCTTTCCCCTCAAAGTTGGTGGACTATTTGAATGG
ACTATAAAGAACTGAAGGATTTGCCTTTTGTAAAATACAA
CACACATTAGAAGTTAACTTATTTTTGAGTCAACTGGAAT
ATATTTATAAGATTTTGTACAGATTTGTTTTGTATTTCCT
TTGATGCTGACGATAGTTCCAAATGTGTTGTGGAATGCGT
GGCTGATATGGTGGACTGAGATGAGCTAGATCTTCAGTCT
GGGCAAAAATGAATCTGGGAACTCCAGATTGCACACCGAA
GTGCCGTTCTGAAAGGCACGCGGATGAAGTGATCTCAGCT
TTGACCAGCGGTTCAGAGGCCTGTCTGCGGGCCTTCCTGT
CTGTCCACTGTCACAATTCGGCTACTCTGCGAGATGAGTT
CGGACGCACAGCTCTCCACCTCGCAGCCTCCATGGGAAAG
CGGGAACTGCTTCAGTGGCTTCTGGACTGTAAACATGCTG
ACCTGTTGGCGAAGGACAAGGAGTCTGGCTGGACTGCACT
GCATCGCAGCGCCTTCTACGGGCAAATTCACTGCCTCATA
ACCCTCATCAAGCGTGGAGGATCGCTGTCCATGCAGGATA
AGGAGGGTCTTTCTGTGCTGGACCTGACCATGAAGGACCG
TCCAGCGCATGTTGTGTATCAAAACACTGACCCTACTGAA
GTGTACACTTGGGGGAACAACACCAATTTCAGCTTGGGAC
ATGGAAACCAGGAGAGCAGACAGCATCCTGAGATCGTGGA
TCTGTTTTCAAGATCTGGAATCTATGTGAAGCAGGTGGTG
CTGTGTAAGTTCCATTCAGTCTTCCTGTCCCAGAAGGGTC
AAGTGTACACATGTGGACACGGACAGGGCGGGAGACTCGG
GCATGGTGATGAAAACACTTATCTGGTTCCTCGGATGGTG
GAGGGGCTTCTGTCTCATCACTGTTCACAGATTGCTGCAG
CACGAGATCACACTGTGGTTCTGACTGAGGAAGGGTATGT
CTACACTTTTGGGCTTAACACCCACCATCAGCTGGGTCTC
GGACCTCCTCCTACGTCCAGCTCAGTTCCCAAACAGGTCA
CATCAAAGTCCCTAAAAGGGAGGTCTGTGATCGGTGTTGC
AGCCGGCAGGTTCCACACTGTTCTTTGGACCAGAGATGCT
GTATATACTGTAGGATTAAATGGAGGCCAACTTGGTTACC
TGCTGGAGCCCAATGGAGAGAAGTGCGTGACCGTTCCCCG
ACAGGTGTCCGCTTTGCTCCACAAGGATGTGACCATCTCT
ATGGTGGCGGCCAGCAATGGAGCCACTGTCTGCGTCACTG
ATAAGGGAGACGTGTACCTGCTGGTTGATTATCAGTGCAA
GAAGCTGGCATCCAAACAGCTGAACCTGAAGAAAATTCTG
GTCAGTGGTGGTAGTTTGGATCATCGTACTGACCCTCAGC
TTCTGCATGATGGTGGAGGAGAGAAGCTGGTGATTCTGGC
TCTGGATGAAACTGGAAGAGTGTTTTCCTGGCGCTCTGTG
GGCACGTCAGCAAGGCTGTGTCGCTGGGCGTATGGGCGCC
AGGTCTTCGTATCAGACATCGCTCTCAGTAAAAACAGCAT
GATGTTTGTCACTCAGGATGGCGAGGGCTTTAGTGGACAG
TGGCTGGGCCAGTACAAGAAAGCTGGAGACAAAAAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ibtk-201 Contained in:
[BAC] CH73-167F23 (1)

Genome Resources: Vega_Trans:OTTDART00000047934 (1),  Ensembl_Trans:ENSDART00000150111 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB839831 (1) 450 nt
CITATIONS (2)