ZFIN ID: ZDB-TSCRIPT-110325-1094
Transcript Name: cyp2aa4-001
Previous Name: ch211-121b5.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048148 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048148|OTTDARG00000034108|ZDB-GENE-040625-72 cyp2aa4|OTTDARP00000037784 CH211-121B5.6-001 LG_ FP015919.8 Danio rerio protein_coding KNOWN, 1841 bp
TTTGTCCTGAACTCAATCTGTCATCATGTTTGGGGCTCTT
GTAAAGTTAGACCTTTCCTCTGTGGGCTTGACTCTGTTGC
TGGGCTTGATTCTTCTGGTTCTGTTTGAGATCTTCAGGAT
TCATTCTTACAAAAGTCGATTTCCGCCTGGTCCAACACCT
CTGCCTTTTGTGGGAAACCTACCACATTTATTGAGGGACC
CGATGGGCTTCAACAGATTAATGGCTCAATATGGAGAAAT
GTCCACTATGTATCTTGGGAAAAAGCCAGCGATAGTCCTC
AATACAATCCAGGTGGCTAAGGAAGCCCTGGTTCAGGAAG
CTTTTGCTGGAAGACCATGTCTGCCGGTTATAGACTGGAC
TTCTAATGGATGCGGTATAATAATGGCCACATTTAACAAC
TCCTGGAAGCAGCAGAGACGGTTTGCTCTGCACACGCTCA
GAAACTTTGGCTTGGGGAAGAAATCAATAGAAAGTCGTGT
GTTAGAGGAAAGCCAATATCTGTTTGCTGAACTGCTCAAA
GATGAAGGTGAGCCAGTGAATCCCCATCATGCCCTACAGA
ATGCCGTTTCCAACATTTTCTGCTCCATCATGTTTGGAGA
GCGATTTGACTACGATAACAAACGCTTAGGCTACCTTCTG
AAAATCCTGAATGAAAACATGATGCTGACAGGATCAGCTA
TAGGACAGATTTTCAACTTGGCCCCGTTCATCAAGCATTT
CCCTGGTCCACACCAGAAGATCAAGAAGAACTCCAATGAG
TTATATAGTTTCATTGAGGATGAAGTTGAGGAACACAGAA
AAACTCTGGATCCAGTCAGTCCACGAGACTTCATAGATGC
CTATCTGCTGGAGATCGAGAAACAAAAGTCTAACAAAGAC
TCCACATTTCAAGAAGAAAACCTGATTGGTTCAGCTATTG
ACCTGTTTTTTGCTGGAACCGACAGCACAGCGACCAGCAT
CAGATGGGGACTCCTCTTCTTGATTCAAAACCCAGACGTA
CAAGAGAGATGTCATGAGGAGATTGTTCAGGTTCTGGGTT
ACGACCGCTTGCCCTGCATGGATGACTGTGACAGACTACC
ATACACACACGCCACTGTTCATGAGATTCAGCGCTTTGCA
AAAACTGTACCTTTCGGTGTGTTTCATGAAACAATTTGGC
CCACAAAACTACATGGATTTGACATTCCTCAGGGAACTAT
GATCATGACAAACTTGGCTGCAATTTTCAGCAGTAAGGAG
CACTGGAAGCATCCTGACACATTTAACCCAGAGAATTTCC
TTGATGAGAACGGACACTTCAGCAAGCCTGAGTCTTACAT
TCCATTTTCCCTGGGGCTGAGGGCCTGTATAGGTGAGTCA
CTAGTGAGGACGGAGCTCTTCTTGTTCGCCACTGTTCTCC
TACAGAGGATTCATTTCTCTTGGCCGCCTGATGCAAAGCC
CTTAGACATGGATGGCATCGTGGGTATAGTCCGCTATCCT
CAAACCTTTAGCATCATCTGCTGCAGTAGAGACAGCAAAA
AGTGACCCGAAACACATCAAGCCATAACATACAAAGGAAA
AACAATAACAGCACAGCCGTTGAGCGCAGAAGAGCACTTT
GGCTCATCTATATCATGTATAATTCACAGTTCTCAGGTAA
CTCAGATAATAAAAAGAAGAGTGTGTATTATTCTTTGCAT
TGATGCTTCTTAACATGTTTGAACATTTAAGCAGTTTTTT
AATCTTCATGCAATCAAAAATTGAATAGTTTTTACCCTTT
GTTTTGACTTTATTCTAATTATTTTATTCTGATTATTGTA
CTGTAATGATCTTTCATTAAATAAAGAATTAATGAAATAA
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp2aa4-001 Contained in:
OTHER cyp2aa4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048148 (1)
  • Ensembl_Trans:ENSDART00000164249 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071533 (1) 1874bp
    GenBank:AB303423 (1) 1642bp
    CITATIONS (2)