Transcript

cyp2aa4-201

ID
ZDB-TSCRIPT-110325-1094
Name
cyp2aa4-201
Previous Names
  • ch211-121b5.6-001
  • cyp2aa4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048148 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048148|OTTDARG00000034108|ZDB-GENE-040625-72 cyp2aa4|OTTDARP00000037784 CH211-121B5.6-001 LG_ FP015919.8 Danio rerio protein_coding KNOWN, 1841 bp
TTTGTCCTGAACTCAATCTGTCATCATGTTTGGGGCTCTT
GTAAAGTTAGACCTTTCCTCTGTGGGCTTGACTCTGTTGC
TGGGCTTGATTCTTCTGGTTCTGTTTGAGATCTTCAGGAT
TCATTCTTACAAAAGTCGATTTCCGCCTGGTCCAACACCT
CTGCCTTTTGTGGGAAACCTACCACATTTATTGAGGGACC
CGATGGGCTTCAACAGATTAATGGCTCAATATGGAGAAAT
GTCCACTATGTATCTTGGGAAAAAGCCAGCGATAGTCCTC
AATACAATCCAGGTGGCTAAGGAAGCCCTGGTTCAGGAAG
CTTTTGCTGGAAGACCATGTCTGCCGGTTATAGACTGGAC
TTCTAATGGATGCGGTATAATAATGGCCACATTTAACAAC
TCCTGGAAGCAGCAGAGACGGTTTGCTCTGCACACGCTCA
GAAACTTTGGCTTGGGGAAGAAATCAATAGAAAGTCGTGT
GTTAGAGGAAAGCCAATATCTGTTTGCTGAACTGCTCAAA
GATGAAGGTGAGCCAGTGAATCCCCATCATGCCCTACAGA
ATGCCGTTTCCAACATTTTCTGCTCCATCATGTTTGGAGA
GCGATTTGACTACGATAACAAACGCTTAGGCTACCTTCTG
AAAATCCTGAATGAAAACATGATGCTGACAGGATCAGCTA
TAGGACAGATTTTCAACTTGGCCCCGTTCATCAAGCATTT
CCCTGGTCCACACCAGAAGATCAAGAAGAACTCCAATGAG
TTATATAGTTTCATTGAGGATGAAGTTGAGGAACACAGAA
AAACTCTGGATCCAGTCAGTCCACGAGACTTCATAGATGC
CTATCTGCTGGAGATCGAGAAACAAAAGTCTAACAAAGAC
TCCACATTTCAAGAAGAAAACCTGATTGGTTCAGCTATTG
ACCTGTTTTTTGCTGGAACCGACAGCACAGCGACCAGCAT
CAGATGGGGACTCCTCTTCTTGATTCAAAACCCAGACGTA
CAAGAGAGATGTCATGAGGAGATTGTTCAGGTTCTGGGTT
ACGACCGCTTGCCCTGCATGGATGACTGTGACAGACTACC
ATACACACACGCCACTGTTCATGAGATTCAGCGCTTTGCA
AAAACTGTACCTTTCGGTGTGTTTCATGAAACAATTTGGC
CCACAAAACTACATGGATTTGACATTCCTCAGGGAACTAT
GATCATGACAAACTTGGCTGCAATTTTCAGCAGTAAGGAG
CACTGGAAGCATCCTGACACATTTAACCCAGAGAATTTCC
TTGATGAGAACGGACACTTCAGCAAGCCTGAGTCTTACAT
TCCATTTTCCCTGGGGCTGAGGGCCTGTATAGGTGAGTCA
CTAGTGAGGACGGAGCTCTTCTTGTTCGCCACTGTTCTCC
TACAGAGGATTCATTTCTCTTGGCCGCCTGATGCAAAGCC
CTTAGACATGGATGGCATCGTGGGTATAGTCCGCTATCCT
CAAACCTTTAGCATCATCTGCTGCAGTAGAGACAGCAAAA
AGTGACCCGAAACACATCAAGCCATAACATACAAAGGAAA
AACAATAACAGCACAGCCGTTGAGCGCAGAAGAGCACTTT
GGCTCATCTATATCATGTATAATTCACAGTTCTCAGGTAA
CTCAGATAATAAAAAGAAGAGTGTGTATTATTCTTTGCAT
TGATGCTTCTTAACATGTTTGAACATTTAAGCAGTTTTTT
AATCTTCATGCAATCAAAAATTGAATAGTTTTTACCCTTT
GTTTTGACTTTATTCTAATTATTTTATTCTGATTATTGTA
CTGTAATGATCTTTCATTAAATAAAGAATTAATGAAATAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations