Transcript

dhx35-202

ID
ZDB-TSCRIPT-110325-1076
Name
dhx35-202
Previous Names
  • ch1073-164f17.1-001
  • zgc:158828-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048086 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048086|OTTDARG00000034072|ZDB-GENE-070410-11 zgc:158828|OTTDARP00000037734 CH1073-164F17.1-001 LG_ FP067435.3 Danio rerio protein_coding KNOWN, 2704 bp
AAATTCCAGGACTTCTTCAACCTGAACGAGTCTGGAGACG
CCAGTAAAGACACCTGTGGGATCCTGACGGTTGAGGGACG
GACGTTCCCTGTGGACATCTTCTACACCGTCAGCCCTGTG
CCAGACTATGTGAAGGCTACGGTGGAGACAGTGCTGAAGA
TTCACGAGACGGAGGATGATGGAGATGTGCTGGCCTTTCT
CACAGGACAGGAGGAGGTGGAGAAGGTGGTGTCTCTGCTG
CAGGAACAGGCTAGAACGCTGTCCCGCTACGGGATGAAGA
AGCATCTGTGTGTCCTGCCCATGTACGCCGGCCTGCCCTA
TAATGAGCAGATGAGGGTGTTTGAGAGGATGGCTCCTACT
GTCCGAAAGGTTGTGGTTGCGACCAATATAGCGGAAACAT
CGATCACTATTAATGGAGTGGTGTTTGTGATTGACTGCGC
ATTTGTCAAAATAAGGGCTTATAATCCCAGGACAGCCATT
GAATCTCTGATCGTCACGCCAATCTCTAAAGCCTCGGCCT
GTCAGAGAGCTGGACGAGCCGGACGAAACCGAGCAGGGAA
ATGTTTCCGTCTGTACACAGAGGAGGACTTTGAGAAGTTG
CCCGAGTCTACTGTTCCTGAGATGCAGCGCTCCAATCTGG
CTCCGGTCATCCTGCAGCTCAAAGCTCTGGGCATCGACAA
CGTGCTGCGCTTCAGCTTTCTGTCGCCTCCGCCGGCTCAG
TCTATGGTTCAGGCTCTGGAGCTGCTCTTCGCTCTCGGAG
GACTGGATCAGTACGGCCGTCTTACCGATCCCATGGGAGT
GCGAATGGCGGAGTTTCCTCTCAGCCCCATGTTCGCAAAG
ATGCTCCTGGAGTCTGGAAACTTCGGCTGCTCCAAAGAGA
TCGTCACTATAGCGGCCATGATGCAGATCCAGAACATTTT
CGTTGCGCCACACAATCAGAGGAAATCGGCCGCACGGGAA
CACAGGAAGTTTGCTGTGGCTGAAGGTGATCATCTCACCA
TGCTGAATGTGTATGAAGCCTTCATAAAGCATCAGAAGAG
CTCTCAGTGGTGTCAGGATCACTTCCTCAATTATAAAGGT
CTCCTACGCGCCACCGCTGTCCGAGAGCAGCTACGACACC
TGCTCAACAAGTTTAAGGTGCCTCGCACGTCCAGCGAAGG
GGATCCGGATGTGATTCTCAGATGTATCGTCTCTGGGTTT
TTTGCTAACGCGGCCCGCATGCATCACTCCGGCTCCTACA
GGACTCTTCGTGATGACCGAGAGCTGTACATTCACCCTGA
TTCAGTGCTATATGGAGAAAAGCCCCCCAAATGGGTGGTC
TTCAATGAGGTAGTTCAGACCAGCAAGTACTACATGCGGG
ACGTGACAGCTGTGGAGTCGTCCTGGCTGGTGGAGCTGGC
GCCGCACTTCTATAAACAAGCCAAACACGGGTCTCTGAGC
AGCAAACGAGCCAAAGTCTTCTGAGCGACTGCATTCACAT
CTCTCACATCTGGATATATTCCTGACCCATAGTTACAGCA
AGCGCTCCTGTGAAGATGACGACACACGCTCTGGGTGTTT
ATTTCCGCCGTACGGCGAAGGAAACACTGTGTTATTGTGT
ACATACAGATGTAAATGATCTATTTATGCTGTCATGGTCA
TCTTTGTGTTATTGAATAGCTTTTTAGTGACAGTGGAAGA
ACCTGACTGTGATTTTACTGTTTACTGACTGGACGGACGG
ATATTAATGTACAGCTTTACAACATCGCACGACCCTCAAC
AATAACCATATTATGACTATAATAAGCTATTTTTTACCAG
TTATTTCAAAGCCTCATCGGAGAAATACTGTGTAGCTCAA
TTGTAGTGGCCTTTTAACCATTATGTGCCAAATATTAATA
CAATGTAGATCTTTTCCTAATGTACTATATGGAATGTACT
ATTCATTGTAGCTACACTTGTACGCATGCGACAAAAAGTG
CCATTTTTTTATTTTGTGTGTGTGTGTCCCTCTTATATAT
ACATATATACACCTTGTTGTGCCCCTCTGGCCTAGAAAAC
TGTGTTCTTAGATGTAGTTTTTCATTTAATTTAGGAAAGA
TCAGCCATGATTAGTTGTTTAAGCATGGTGAGGAAATAGC
ACAGTGAACAAGACGCCTCAGGGAGGAGATTATTTCATAT
TAAATCATATATACATAAACTGGGTGCTTACCAAAAACTG
TATGTGCGACGTGACATTTCATAGGACGGCTGAGGTGTCA
GTCATACTAAAGGAGGCGGAGCCAATCTTGTTTTGATTTA
ATGTTTTCACATAGGTTTCTTTTTTCCTCAGCTAGTTATT
TATTCCATTTCAGAAAGCATTTTAGTTTAAGGTTACTTCT
ATAACCTTTACCAAATGTCTTAGTAAGCATATTCTGTGTA
TACTTAGTCGGTAGCCTCGAGCAGCGTAGATTAGCTGTTG
GTTTGACAAATATGACATTCAGTCCGAATATGAGAGATCT
TCACACGTTCCTGCATGTCTTTAAACAGAACACACCTCAT
GTGGTTTCACAGCAGTGCAGTTATTTGTAGAGGAAATCTT
AAGGTAAATATGTAGTTTCGCCAGTCTCTCACCAAACGTG
CAGATATCTGTATATTTAATGAAGTCCAATGGTCACAGTG
TATTCATGTGCAGAGTCTGTACTGAGGTCTGTTTTACAAA
CAATAAAGGAGGAAACTCTGGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations