header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-107
Transcript Name: serpinb8 (1 of many)-201
Previous Names: ch73-303g23.2-001, zgc:173729-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047896 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047896|OTTDARG00000033962|ZDB-GENE-071004-64 zgc:173729|OTTDARP00000037592 CH73-303G23.2-001 LG_ CU469384.8 Danio rerio protein_coding KNOWN, 1492 bp
AGCCTTTAAAAGAAATACACCCATAACCGTCATTTCATTC
GTCTCAAAGACTCAGGAAACACTTCATCATTTGTGCTGTG
AGTCGAAGCTTGTGAAAATGGAGTCTCTGTCTGCAGCAAA
CACACAGTTTTCCCTCAACCTGTTCAAGAAGATCAGCGGA
GGAAACGCATCAGGAAATGTGTTTTATTCTCCTGTCAGCA
TCTCCTCGGCTCTGGCCATGGTGTCGCTCGGTGCCAAAGG
AAACACCGCAGATCAGATGTTTAAGGTCTTGGGCTTCAAC
AATCCTCCCAAACCTGGCGGAGCGACTCCAACTCCTGCAC
AAGCAACCCAGAAGCCCCAGATAACATGTGGAGTCAAGAG
TCAACATGAGCCACAAGCGCTGCAACAGCCACAGAAGTTT
GAGTTACCTGCCGACCTCAAGAAATGTCCTGCTCAGCCGG
TGCCTGGACAAAAAGCTGAGGAGCAAATTCACTCAAGCTT
CAACAAGTTCATGAGTGAACTGAACAAACCAGGAGCCCCG
TATGTGCTGAGTCTCGCCAACCGCCTCTACGGAGAGCAGA
CCTACCAGTTCCTTGAGAAATTCCTCTGTGATGCAAAAAC
TTACTATGCAGCCGGACTGGAGAAGGTGGACTTCAAAAAT
AAATCCGAAGCTTCACGTGTCAGCATCAACAAATGGGTGG
AGAAAAACACACAAGAGAAGATCAAGGATTTGCTGCCGTC
AGGAGCCATTGATGCAATGACGAGACTGGTTTTGGTGAAC
GCCATCTACTTCAAGGGGAACTGGGAGAAGAAATTTACAA
AGGAAGCCACCAGAGATGGGCAGTTCAAGCTGAACAAGAA
TCAAACTAAACCAGTGAAAATGATGCATCAGAAAGCTCGC
TTTTCACTGGCTTCAATCCCAGAGATGAACAGTCAGGTTC
TGGAGCTGCCGTATGTGGGGAAGAATCTCAGTATGTTGAT
CATCCTTCCTGATCAGATTGAAGACGCAACCACCGGCCTT
CAGAAGCTTGAGAAGGCACTGACCTACGAGAAGCTCATGG
AGTGGACCAAACCTAGCATGATGTGTCAACAGGAAGTACA
AGTCTCTCTGCCCAAATTCAAGACGGAGCAAACCTACGAC
ATGAAGAGTCTTCTGGTCAGCATGGGGATGGAGGATGTGT
TTGACCCACAGAAGGTTAATCTAACAGGCATGTCCTCCAG
CAATGACCTGGTGCTGTCCAAGGTCATTCATAAAGCCTTT
GTTGAAGTCAATGAAGAAGGAACCGAAGCGGCTGCGGCCA
CCGGCGTCATCGCCACATTAACATCCATGCCTTTATCACC
CCCAAAAACCTTCACTGCAGATCATCCGTTCATTTTCTTC
ATCCGACACAATCCCACAAATGCCATTCTGTTTTATGGAC
GCTTCAGTTCTCCTTAATGGAAACCATATGATGATGGATT
AGTAATAGTAGGCGACTGTGTTTCTGTAGTAAATAAAGGA
TCTAGCAAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
serpinb8 (1 of many)-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000047896 (1),  Ensembl_Trans:ENSDART00000079864 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)