Transcript

pou4f3-201

ID
ZDB-TSCRIPT-110325-1047
Name
pou4f3-201
Previous Names
  • pou4f3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047998 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047998|OTTDARG00000034021|ZDB-GENE-990415-24 pou4f3|OTTDARP00000037663 pou4f3-001 LG_ CU468941.10 Danio rerio protein_coding KNOWN, 996 bp
ATGATGACCATGAACGGCAAGCAGCACTTCTCCATGCACC
CTGCGCTGCACCCGAGCTCCGAGGGCATGCGGCGGGTGTG
CCTACCTGCCCCGCAGCTCCAGGGCAATATATTCAGCGGC
TTTGATGAGAGTCTGCTGGCCCGCGCTGAAGCTCTGGCGG
CGGCTGACATCGTGTCTCACGGCAAGAGTCACCCTTTCAA
GACGGACGTCACCTACCATACCATGAGCAGCGTGCCCTGC
ACCTCCTCTTCGTCCACAGTGCCCATATCTCACCCATCAT
CCAACCTCCCGTCGCATCATCACCACCACCTCAGCCACCA
GACCCTGGAGGGGGACCTACTCGACCACATTTCCTCGAGT
TTATCGGTCAGCGGCATGGGGGCGCCGCCGGATCCATCGG
TGATGACCACACAAGCCCACCAGCATCACCTGCAAATGGG
TCACTTACACCAAGCAATGGCGATGGGCCACCCGCACACC
CTGTCGGTCCACAACGGCATGGCGTGCGTCAACGACGTCG
AGTCCGATCCAAGAGAGCTGGAGGCGTTCGCGGAGAGGTT
CAAGCAGCGGAGGATAAAGTTAGGAGTGACCCAGGCGGAT
GTGGGCTCTGCTCTCGCCAACCTGAAGATACCGGGGGTCG
GCTCGCTGAGCCAAAGCACCATCTGCAGGTTCGAGTCCTT
AACACTTTCACACAACAACATGATCGCCCTCAAACCCGTC
CTCCAAGCTTGGCTGGAGGAAGCTGAAGCTGCTTACCGGG
AGAAAAACGGGAAACCGGACCTTTTCAATGGGAACGAGAG
GAAACGAAAGCGTACGTCCATCGCAGCTCCGGAGAAGCGA
TCGCTCGAGGCATATTTTGCAATCCAGCCGCGACCGTCGT
CGGAAAAAATCGCGGCTATCGCGGAGAAGTTGGATCTAAA
GAAGAACGTGGTTCGGGTTTGGTTCTGTAATCAACGGCAA
AAACAGAAAAGGATGAAGTATTCAGCAGTGCACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations