Transcript

ddr2l-202

ID
ZDB-TSCRIPT-110325-1030
Name
ddr2l-202
Previous Names
  • ddr2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047945 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047945|OTTDARG00000033994|ZDB-GENE-041210-162 ddr2l|OTTDARP00000037626 ddr2l-001 LG_ FP015875.13 Danio rerio protein_coding KNOWN, 2654 bp
CACCAATGGCCAGATAGACCCAGCTCACTGTCGGTATCCT
CTCGGCATGGAGGATGGCAGGATCAAAAACGACGACATTA
CAGCCTCCAGCCAGTGGTACGACAGCACAGGCCCTCAATA
TGCAAGGTTGAACCGTGAGGAGGGAGAAGGTGCCTGGTGT
GCTGCTGGTCAACTGCAGCCCTCAGATGTTCAGTATCTTC
AGATTGACCTTCGTCAGCTCATCTTCCTCACCGTTGTTGC
CACACAGGGACGCTACGCTCGCAACTCCGGCATCGAATTC
GCACGCAAGTACCGTTTGGAGTACAGCAGAGATGGACACC
GCTGGATCTCCTGGAGAAACCGCTTCGGCAATGAGATTAT
AATGGGCAATGTGAACACCTACGACACTGTGGTGCGAGAT
CTCCATCCTCCCATCATCACTCGATTCCTGCGCCTGATTC
CTGTCACTGACGCCGTTCACACTGTGTGTATGAGAGTGGA
GCTGTTTGGGTGCGCCTGGCAGGATGGCCTGATGGCGTAC
AGCTCTCCGGAGGGTCAAATCATGATGGCTCCTGGATTTC
CCATTACATCCCTCAATGACTCTACATATGACGGACCCCT
GGAGCGCAGGAAGTTGTCGGGGGGTCTGGGACAGCTGGCC
GATGGGGTGGTCGGCCTGGATGATTTCGTGGAGAGCAGGC
AGTACCGACTGTGGCCCGGATACGACTATGTGGGCTGGAG
GAACGATGGCTTGGGCCCTGCATATGTGGAGATGGAGTTC
CAGTTTGACAGACAACGAAACTTCACCTCCATGAAGGTTC
ACAGCAATAACATGTTCTCTATGGGTGTGAAGATCTTCTC
GTCTGTGTCCTGTGTATTCAAGCTCCACCTCATTTCTGAG
TGGGAGTCTGAACCGGTGGAGTTTCACACAGTTATAGATG
ACAGGAATCCGAGCGCTCGTTACGTGACCGTCCCGTTAAA
GCACAGATCGGCCACAGCTCTGCGCTGCCGCTTCTACTTC
GCGGACACCTGGATGATGTTCAGCGAGATCTCCTTTCAGT
CTGTAACTATTGTGCTTCCTACTAAGAAACCTCCAGTTTT
GACGCCTCCTTCATATGAAGCTAACAGCGAAATACCAGAA
ACTACACAAAAAACAGAGGACTGGACGACGCCAACAAAGA
CGGGCTCTCCAGAAGAGGGCAATACTTCCATTCTGATTGG
CTGTCTGGTGACTATTATTCTGCTGCTGGTGGTGATCATC
TTCCTCATTCTGTGGTGCCAGTATGTGTGCAAAGTCCTGG
AGAAGGCTCCAAGGCGTATTTTGGAGGAGGAGGTGGCTGT
GCGTTTGTCATCCAGCAGTGACACCATTATCCTCCAGACT
CCTCCAGTGCCTCCGCGAGTCTCCATCGACCCTCCGTATG
AGAGGATCTTCCTGCTAGACCCCCAGTATCAGGACCCTGC
TGCGCTCAGGAACAAACTTCCAGAGCTTTCTCAAAGTGCA
GAGACTTCAGCCTGTAGTGGAGGATACGCAGAGCCAGATG
TGACACTCTGCACCCCTCACCAGAGTTTTCAGAGCAGCGC
ACCGCACTATGCAGAAACAGACATCATCAGCCTGCAGGGT
GTCACCGGCAGCAACATGTACTCGGTCCCAGCACTCACCG
TCGACTCCCTGACCCGGAAGGACATCTCTGTGGCTGAGTT
CCCTCGACAGAGACTGCTGTTCAGAGAGAAACTGGGAGAG
GGGCAGTTTGGAGAGGTGCATCTGTGTGAGGCAGAGGGAT
TAGCAGAGTTTTTGGGGGAAGGTGCACCTTTACCGGAGCA
GGACGGCAGGCCAGTGCTGGTAGCAGTGAAGCAGCTCAGA
GCAGATGCCACCAGCAATGCCAGGAATGATTTCCTGAAGG
AGATAAAGATCATGTCTCGTCTGAATAACCCGAACATCAT
TCAGCTGCTGTGTGTTTGCGTGAGCTCGGACCCGCTCTGC
ATGGTGACCGAATACATGGAGAACGGAGACCTTAACATGT
TCCTGTCCCAGAGAGAGATCGAGAGCACGCTCACACACGC
CAACAACATTCCCTCCGTCAGCATAGCTGACCTGTTGCAC
ATGTCAGTTCAGATCTCGTCTGGGATGAAGTATTTGGCTT
CTCTGAACTTTGTGCATCGTGATCTGGCCACACGAAACTG
CCTGCTGGACCGTCACCTCACCATAAAGATCTCTGACTTC
GGCATGAGTAGAAACCTGTATAGCAGTGATTACTACCGTA
TACAGGGGCGAGCAGTGCTGCCGATACGCTGGATGGCCTG
GGAGAGCATATTACTGGGTAAGTTCACCACTGCTAGTGAC
GTGTGGGCATTTGGAGTGACTCTGTGGGAGATCTTCACTT
TATGTAAGGAGCAGCCCTACAGCCTGCTGTCTGATGAACA
GGTGATCGAGAACACCGGAGAGTTCTTCAGGAACCAGGGC
AGACAGATCTTTCTCTCCGCTCCGCCGCTCTGCCCATCCT
CCCTCTTCAAGCTGATGATGCGCTGCTGGAGTCGTGACAT
CACAGACCGGCCATCGTTTAACAAATTGCATCAGGCCCTG
CGAACTTTTGCACCCCATTCGTGACTGACATCTGCTCTAC
TAAAGCAACCTGGAGGAAAACTGCTATAAACATAGAGCGG
GAACATTTTAGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations