Transcript

serpinb1l1-201

ID
ZDB-TSCRIPT-110325-1015
Name
serpinb1l1-201
Previous Names
  • serpinb1l1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047897 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047897|OTTDARG00000033963|ZDB-GENE-040715-5 serpinb1l1|OTTDARP00000037593 serpinb1l1-001 LG_ CU469384.8 Danio rerio protein_coding KNOWN, 1453 bp
CTTCTCTCTTCATATACAGAGACTTGGCTTGTACAGGAGG
GCTGGCTGAGGTTTAGAGGATCGGCATTTCAGGGCGAGGC
AACATCTTGTGAAAATGGAGTCTCTGTCTGCAGCAAACAC
ACAGTTTTCCCTCAACCTGTTCAAGAAGATCAGCGGAGGA
AACGCATCAGGAAATGTGTTTTATTCTCCTGTCAGCATCT
CCTCGGCTCTGGCCATGGTGTCGCTCGGTGCCAAAGGAAA
CACCGCAGATCAGATGTTTAAGGTGTTGGGATTTAACAGT
CAAGCTCATCAACCAGTGGAGCAGATTCACTCAAACTTCA
AAAAGTTTATGAGTGAACTGAACAAACCAGAAGCCCCGTA
TGTGCTGAGTCTTGCCAACCGCCTCTACGGAGAGCAAACC
TACCAGTTAATTGAGAAATTCCTCAATGACACAAAAAGAT
ACTATGACGCCGGACTGGAGAAGGTGGACTTCATAAATAA
ATCAGAGGACGCACGTGTCAACATCAACACATGGGTGGAG
AAAAACACACAAGAGAAGATCAAGGATTTGCTGCCATCAG
GAGCCATTGATGCAATGACGAGACTGGTTTTGGTGAACGC
CATCTACTTCAAGGGGAATTGGGAGGAAAAATTCCCAAAG
GAAGCCACTAGAGATGGCGTGTTTAGGCTGAACAAGAATC
AAACTAAACCAGTGAAGATGATGCATCAGAAAGCAGAGTT
TCCAAGTGGCTACATCGAAGAAATGAAGAGTCATGTTCTG
GAGCTGCCGTATGCAGGGAAGAATCTCAGTATGTTGATCA
TCCTTCCTGATGAGATTGAAGACGAAACCACCGGCCTTCA
GAAGCTTGAGAGGGCACTGACCTATGAGAAGCTCATGGAG
TGGACCAAACCAGAAGTGATGCATCAACGGGAAGTTCAAG
TCTCTCTGCCCAAATTCAAGACGGAGCAAACCTACGACAT
GAAGAGTCTTCTGGTCAGCATGGGGATGGAGGATGTGTTT
GACCCACAGAAGGTTAATCTAACAGGCATGTCCTCCAGCA
ATGACCTGGTGCTGTCCAAGGCCATTCATAAAGCCTTTGT
TGAGGTCAACGAAGAAGGAACCGAAGCGGCTGCGGCCACT
GCTGCCATCGAGAAGTTAATGTGCTACATCCCGCCACTGT
CTTTTAATGCAGATCATCCGTTCCTTTTCTTCATCCGACA
CAATCCCACCAAGAGCATTCTGTTTTATGGACGCTTATGT
TCTCCTTAGAGATGCTAATGTTGCTGTGATGATAACTGAT
GCCTGTGTTTCTATTATGATCAAATCCTCTACAAAAAACT
GAGTGTGCGTCTGGATTTTTTTTGCAGTGAGCGTATTACT
CAGCTTTTACAGCACAGAATGAGAAAGACATGTTGCTACA
CACTCATTCAGAAGTTACTGTATGTTAATTCAACCCATCC
CTACGATCGCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations