Transcript

cyp2aa2-201

ID
ZDB-TSCRIPT-100915-930
Name
cyp2aa2-201
Previous Names
  • cyp2aa2-001
  • dkey-12m15.3-001
  • zgc:153597-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047008 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047008|OTTDARG00000033428|ZDB-GENE-061027-232 cyp2aa2|OTTDARP00000036998 DKEY-12M15.3-001 LG_ CU013526.13 Danio rerio protein_coding NOVEL, 1823 bp
AAGCCCCTGACCCTCTGCTGCTCTTGTATCTGTCTTGAAC
TCAATCTGTTATCATGTTGGCGGCTCTCCTTAAGTTAGAC
TTGGCCTCTGTGGGCTTGACTCTGTTCCTGGGCTTAATTT
TTCTGGTTCTGTTTGAGATCTTCAGGATTTATTCATACAA
AGGTCGATTTCCACCTGGTCCAACACCTCTGCCTTTTGTG
GGAAACTTACCACATTTATTGAAGAACCCGATGGGCTTCA
AAAGATCTTTGTCTGAATATGGAGGATTGGCCACTGTGTT
TATTGGGAGAAAGCCAGCAATAAGCATCAATACAATCCAA
CTGGCTAAGGAAGCATTAGTACAGGATGTTTTTTCTGGAA
GACCTGCTTTGCCTATTTTTGACTGGATATCTCATGGACT
CGGTATAATAATGGTCACATTTAACCACTCTTGGAGGCAG
CAGAGACGGTTCGCTCTGCACACACTCAGAAACTTTGGTC
TGGGGAAGAAAACAGTAGAGGATCGAGTGTTAGAGGAAAG
CCAGTATCTGATTGCTGAAATGCTCAAAGATGAAGGCAAG
TCAATGAATCCCCAGCATGCCCTACAGAATGCTGTTTCCA
ACATTATCTGCTCCATCGTGTTTGGAGATCGCTTTGAGTA
TGATAACAAACGCTTTGAATACCTTCTGAAAATCCTGAAT
GAAAACATCATGCTCACAGGGTCAGCTGCAGGACAGATTT
ACAACTTAGTCCCCTTCATCAAGCATTTCCCTGGTCCACA
CCAGAAGATCAAGCAGAACGCCGATGATTTATTTAATTTC
ATCCGAGACGAAGCTAAAGAACACAAACAAACTCTGGATC
CAGACAGTCCACGAGACTTCATTGATGCCTATCTACTGGA
GATCGAGAAACAAAAGTTTAACAAAGACTCCACGTTTCAT
GAAGAACACCTGGTTGTGTCAACATCTGACCTGTTTCTGG
CTGGAACCGACACCACAGAAACCACCATCAGATGGGGACT
CATTTACTTGATTCAAAACCCAGATGTACAAGAGCGATGT
CATGAGGAGATTGTTCAGGTTCTGGGTTACGACCGCTTGC
CCAGCATGGATGACCGTGACAAACTACCGTACACACTCGC
CACTGTTCACGAGATTCAGCGATATGGAAACATTGCACCA
AAATTGTTGCATGAAACAATTCGCCGCACAAAACTACATG
GATACGACATTCCTCAGGGAACTACAATCATAGCAAACTT
TACAGCAATGTTCAGCGATAAGGAGCTCTGGAAACACCCT
GATGCATTTAACCCAGAGAACTTCTTGGATGAGAACGGAC
AGTTCAGCAAGCCAGAGTATTTCTTTCCATTTTCACTGGG
ACCGAGGGCCTGTCTGGGTGAAACGCTGGCAAGGACGGAG
CTCTTCTTGTTCATCACATCTCTCCTACAGAGGATTCGTT
TTTCCTGGCCGCCCAATGCAAAACCCATAGACATGGATGG
CATTGTGGGTATAGTTCGCTCTCCTGAGCCCTTTAACATC
ATCTGTCATAGTAGAGACACCAAAGACTGACCGAAACATG
TTGGACATCATATAATCACACACTGAAGATCAACAATAAC
AACAAAGCTGCAGAGAGACACAAGACCACTTTCTAAACCT
CACGCTGCAGCTTTTTCTATGCAGTTTGGGGATTTTTCCA
CATACAAACACGAGTATAGTGTCACTAAAACTGAATCTTT
TTGAAAACTACAACTTGAGTGAAGATTTATAGCAACTTTG
TTTACAGTAGCTATATTTGGAGATGCCAACATGTGAATAA
CATTTGAAAATGTGCATTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations