Transcript

podn-201

ID
ZDB-TSCRIPT-100915-921
Name
podn-201
Previous Names
  • podn-001
  • ch73-116b16.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046978 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046978|OTTDARG00000033406|ZDB-GENE-100922-117 podn|OTTDARP00000036978 CH73-116B16.1-001 LG_none AL928887.15,CU855854.8 Danio rerio protein_coding NOVEL, 1593 bp
CTGCTGGAGCTCATGTGTTTGCTTTTGCTGGGCTGGACTC
TGATTGTTCGCGGTCAGACAGAAACCGATCTCCACCTGCT
GGATGAAGAGGAAGCAGAGGAGGTGAAAAATGCAGAGGAA
AAGGTATCCTGTCCGGAGAAATGCAGCTGCAGCGGCGAGG
GGGCGGTGGATTGTAATGGAGTGAGTCTCTCTGAATTCCC
GCAGGATTTATCTGAACAGACCCGGCAGCTCTCACTACAG
AATAACCAGATCAGCGAGGTCACGCTGGAACATCTGTCCC
GTCTTCAGCAGTTGGAGACCCTCAATCTACAGAACAACCG
GCTCACAACACAAGGCCTTGAGGACGAAGGGTTTGATATT
CTGGAAAGGCTGAGCTATTTATACTTGGCCAATAATAAAC
TCACCGCAGCTCCCAGACACCTTCCTCCATCTTTGGTCAG
CGCAGATTTTGCCGCTAACCAGCTCACCAAAATCTTCCCC
AACACGTTTGGCCAGAAGCCTGCACTAAAGTCAGTGTATC
TCCATAACAACAAGCTAACGGATGCCGGTCTGCCAGAGAG
CATGTTTAATGGATCAGACAGCCTTGAGATCCTCATTATG
TCCAGTAATTTTCTCCGTTATGTCCCAAAGTATCTGCCCA
CTGCCCTCTACCGCCTACATCTGAAGAACAACAAGCTGGA
GAAGATTCCCTCAGGGGCATTTGATAATTTATTCCATCTT
CGAGAACTTTACCTGCAAAACAACTTCCTGAGTAATGATG
GCATGGACAACGAGACCTTTAGCCATTTGAACAGTCTGGA
ATATCTGGATTTGTCCAATAACAACTTGTCCACAGTTCCC
CTCGGGCTTCCCCGAAATGTTATCCTGCTTCACCTAGAGA
AGAATTCAATCCAGAGCATTGCAGTAAATGCTCTGTCACC
CATTCGAAACCTGGAGTACTTACTCCTCCACAACAACCGC
CTCCGTTCCCGCTCCATCCATCCAGCTGCCTTCCAGGGTC
TGAAACGCCTCCACACCGTCCACATGTACAACAACCTTCT
CGAGCGAGTTCCCCGCGGCCTTCCTCGTCGAGCAAAAACC
CTCATGCTGCTCCATAACCTCATCAGTGAGATTGGACGCA
ACGATCTGATCACACTTTACACCCTCACAGAGCTCAACCT
CAGTTACAACCGCCTCACAAGCGCCAAGCTCCACCGAGAG
GCCTTCAGGAAACTCAGAATCCTGGAGACCCTGGATCTGT
CAGGAAACAAGTTGCAGGCACTGCCACTGGGTCTTCCCAA
AAGTCTCCAAATCCTGAAGGTAAAGGACAACCAGATGACA
GAGATACCAGAAGGGGCTCTGCTGGGAATGACCTCGCTGA
GGGAGCTCTACCTGACCAACAACCAGCTCAAGCTCAGCTC
CATCTACCAGGGTGCGTGGCTAGAAATGAATGCCCTCAAG
ACACTGGATCTCTCTGGTAACATGCTGTCTCACATTCCCC
CTGACCTACCCGAGTCTCTTGAGTTCCTTCACCTGCAGAA
CAACAGAATCAACTCTATTTCAGAAACAGCCTTCCTCAAC
ACACCCAACATCAAAGGAATATTCCTCAGGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations