Transcript

march4 (1 of many)-202

ID
ZDB-TSCRIPT-100915-868
Name
march4 (1 of many)-202
Previous Names
  • dkeyp-88a4.2-001
  • zgc:153256-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046801 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046801|OTTDARG00000033302|ZDB-GENE-060825-323 zgc:153256|OTTDARP00000036867 DKEYP-88A4.2-001 LG_ CR391947.14 Danio rerio protein_coding KNOWN, 1588 bp
AACAACTTGCTGTGTCCAAACGGCTACTTAAAGAGAGGCT
GTGTTGAAAGCGGCGTTCTTCCGGAGACTGAAGCAGCGAC
ACAAGTGTTATTCCTCACTGGAAACTAAACCGTAAGTTGT
GTTATGTGACCTGCTGGAGTCCAGTAACAGATAGCCTTAG
CATTAGAGGCCGTTTAAAAACATAGACCGCCTTTTCATTA
TTCATAAGACGGGCACATGTTGTTGGCTATCGGTGTCATT
GTATGGTGTTGGGGATTGTTGAGTCGCAGACCGATGCTGC
GCCGCCAGGGCAAGCAGAAAGGCCGCTGTTGCGTCTTGTT
CAGTGACCTGAAGGTTTTCCTACTCAGGCCACCGACACCG
TCGGCATCGCCACCTGCCTTCACACCCATGAACGAACTAA
ACGCGGAGGGCAATGCGACGAGCAGCGCCACAGAGAGCCA
CTCTTTAGCCAACGGACATTATCAACCGGTAACAGGTGAG
GAGGCTTTGGACACACGAGGGCCCGATGACTGGACCCATA
GCGTAGTGGACCCGCCGAGGACACTGGACTGCTGCAGCTC
ATCTGAGGATTGTTCTAAGGAAAAGCTGGATGAAAGGTTA
TCACTCAACAGCTGCACGGACAGTGGAGTGAGGACTCCAT
TGTGTCGGATCTGTTTTCAGGGCCCAGAGCAGGGGGAGCT
GCTGAGCCCATGTCGCTGTAGTGGTTCTGTGCGCTGCACT
CATGAGCCCTGTCTTATTAAATGGATTAGTGAGAGAGGAT
CCTGGAGCTGTGAACTCTGCTACTACAAATACCAGGTCAT
CGCCATTAGCACCAAGAACCCACTACAGTGGCAGGCCATC
TCTTTGACAGTGATAGAGAAAGTACAGATAGCTGCAGCCG
TTCTGGGTTCCCTGTTCCTGATAGCCAGTATCTCCTGGCT
GGTGTGGTCATCCCTCAGCCCATCGGCCAAGTGGCAACGG
CAGGACCTGCTCTTTCAGATCTGTTACGCCATGTACGGCT
TCATGGACCTGGTGTGCATCGCCCTGATTGTCCACGAAGG
ACCGTCTGTGTTTCGCATCTTTAACCGCTGGCAGGCTGTC
AATCAGCAGTGGAAAGTCTTAAACTACGACAAGGTCAAAG
ACAATGAGGACCACCAGAAGACTGGTGCCACATTCCGGAC
CCTCTCTCTGCCGCTGACGCACCGCATGGGGCAAAGCGGC
CCTGAAGGCGAACCCTCCACCTCCACATCCTCCCTCATGG
CTGCAGCTGCAGCAGCCGCGGCGGGCACAGTCACCCCTAC
CACAAACTCCATCCCACCGGCAGCAGGTGCTACGACAGAG
CCGCAGGACTCATCTGAGCCCAGCAACGGGCAGCCCTCTC
TGCCAGACCACCACTGTGCTTACAACATCCTTCATCTCCT
CAGCCACCTCAGGCAACAGGAGCCGCGCGGACAAACCAGC
AACAGCAACCGAGAACTGGTCATGAGAGTCACTACAGTCT
GATGCTTCGTTTACACTTCAATCCCTGCATGCGACTTATT
TTAAGGATCGATGGAGCAGAATTAAACAGTGTTACTCGCT
GACCCGGTGCACTGCTGTCTGGGTTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations