ZFIN ID: ZDB-TSCRIPT-100915-835
Transcript Name: si:ch211-254c8.1-001
Previous Name: ch211-254c8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046652 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046652|OTTDARG00000033228|ZDB-GENE-100922-190 si:ch211-254c8.1|no_translation CH211-254C8.1-001 LG_ BX321875.7 Danio rerio processed_transcript PUTATIVE, 951 bp
GAAAAAGAGAATGAAGATGATGGAGGAACAACAGATTCAG
GAGAAAGAGACCATGAAGATGGAGAAACGACAGAATCCGG
TGAAAGTGAGAATGAGAAGAGAAGAAGAGTTCATACAGAG
AAAAGAGGGAAACGAAATGCTTGAAATAATGAAATTGGAG
GGAATTAAGAAACCGAAACCAGAGGAAAGACTGAAAAGAA
GAGAAGAAAAACAGTTATCTGAACTTTACAGGAGACACGA
AAGTCCAGTTACTGGATTCACACCAGTTTGTATGTTATCC
TCGCTGGGAGAAAGAGGTGCTGGGAAAAGTTCATCAGAAG
AAACATTCTTGCGTGGACCAGCATTTGCCTCAAAGAAAAG
CTCTACATTCTCACAAGATGCCGCTGTGGAGGCTGGAGAT
TGGTTTCCAGTCCCTGTTTTTAACACACCAGGATTATCTG
GTTCATATATGACAGGAGGGGGTCAGCAGATGAGGAATGA
AAGCTTTTCACGTCTTCAAACAATGGCAAGTAAAGCAGAG
CGAAAAAAGCCAGAACACACTCTAGTGTCCAGTCTCTCCT
CCAGACGGATTGTTCTTCTGGGTAAATCTGGTGTTGGTAA
AAGTACAGTTGGAAACACAATCCTGGGACAGAAAAAGTTC
TCATGTCAGATAAGGAGCCATTCAGTAACGCGTGTTTGTT
CAGCAGCTCAGGCCACAGTTTCAGGCAGATCTGTGTCTGT
AGTCGACACTCCGGGATTCTTTCACACACATATGAACAAC
AATGAGTTAATGATGGAGATCCGCAGAAGTGTGTATATCT
CCAGTCCTGGACCTCACGCTTTCCTCATTGTGCTGCGTGC
AAATGACAGATTCACTGAACTGGAGCAACAGACTCTTCAG
AAGATTGAGCTGATGTTTGGTAAGGATGTGTTGAATTACT
GCATCATTCTCTTCACTCATGGAGATCTGCT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-254c8.1-001 Contained in:
[BAC] CH211-254C8 (1)

Genome Resources: Vega_Trans:OTTDART00000046652 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EV755074 (1) 932 nt
CITATIONS (1)